Labshake search
Citations for Qiagen :
1 - 50 of 10000+ citations for DNA Damage 8 OHdG ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: To quantify mtDNA damage genomic DNA was extracted from AT2 using the QIAamp DNA mini kit (Qiagen, 51304) and quantified using the PicoGreen assay kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was stopped by adding 2.5 uL of 0.5M EDTA pH 8 and transposed DNA was purified using Qiagen MiniElute PCR purification kit (Qiagen). Purified DNA was amplified using the following condition ...
-
bioRxiv - Systems Biology 2020Quote: ... IL-8 ELISA was performed according to manufacturer instructions (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... and 8 h post-infection) using the QIAamp DNA micro kit (QIAGEN). As a parallel control ...
-
bioRxiv - Immunology 2022Quote: ... genomic DNA was isolated 3 or 8 days after editing by a QIAamp DNA Mini Kit or Micro Kit (QIAGEN). The genomic region flanking the CRISPR/Cas9 cleavage site was PCR-amplified ...
-
bioRxiv - Microbiology 2020Quote: DNA extractions from the 8-week fecal samples (n = 8 per group) were performed using the Qiagen QIAmp DNA stool extraction kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: DNA was isolated from the cells on day 8 after transduction using QiaAMP DNA blood mini kit (Qiagen) as per the manufacturer’s protocol and eluted in nuclease free water.
-
bioRxiv - Biochemistry 2024Quote: ... ∼8 ml PCR product (azide-DNA:2xbiotin-DNA = 1:1) was purified using HiSpeed Plasmid Maxi kit (Qiagen) in 1 ml NaHCO3 (pH 8.3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was isolated from >8 bacterial colonies using QIAprep® Spin Miniprep Kit (Qiagen) and TRIM1 knockout confirmed by sequencing using a T3 forward promoter to confirm truncating stop codons in all copies of the TRIM1 gene present in the genome of selected clones ...
-
bioRxiv - Microbiology 2019Quote: ... DNA extractions were performed using a DNeasy PowerSoil 96-well plate DNA extraction kit (Qiagen, Hilden, Germany). The standard protocol was used with the following two exceptions ...
-
bioRxiv - Neuroscience 2020Quote: DNA and RNA from 8-10 mice was isolated and purified with AllPrep-DNA/RNA/miRNA-universal kit (Qiagen, Montreal, QC) and concentrations were determined by fluorometry on the Qubit system (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... DNA was extracted in pools of 6-8 adult mosquitoes mosquitoes using Blood & Cell Culture DNA Midi Kit (Qiagen, Cat# 13343) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... amplified with 8 cycles PCR using Kapa HiFi DNA polymerase and purified using GeneRead kit (Qiagen). Concentrations were determined using a Bioanalyser 7500 DNA chip ...
-
bioRxiv - Developmental Biology 2022Quote: ... Genomic DNA from 4-8 microdissected 10 μm FFPE sections were extracted using the QIAamp DNA FFPE Tissue kit (Qiagen, cat. no. 56404) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNA was isolated from 5 million cells using the DNAeasy kit (Qiagen). 4ug gDNA was digested with NlaIII or MseI ...
-
bioRxiv - Microbiology 2019Quote: A549 or DF-1 cells in 6-well plates were infected with the specified IAVs and total RNA was extracted 8 hpi using a RNeasy Kit (Qiagen). Total RNA was eluted in RNase-free water and stored at −80 °C until needed.
-
bioRxiv - Developmental Biology 2021Quote: Organoids from a single 48-well plate well were used for genomic DNA extraction with QIAamp Fast DNA Tissue Kit (51404, Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... Plates grown in parallel were used for genomic DNA extraction (DNeasy Blood & Tissue kit, Qiagen), and RNA extraction (TRIzol ...
-
bioRxiv - Microbiology 2021Quote: ... a volume equivalent to 5×108 cells were spun down (assuming 1 OD600=8×108 cells) and Protect Bacteria RNA Mini Kit (Qiagen) was used to extract total RNA as described in (Bhattacharyya et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples from the GSK-3484862 and 5-azacytidine treated assays had RNA and DNA isolated simultaneously using the AllPrep DNA/RNA kit (Qiagen), whereas only RNA was isolated from decitabine samples by using the RNAzol total RNA protocol (Sigma) ...
-
bioRxiv - Microbiology 2022Quote: ... the slurry was diluted to an OD600 of 5 and genomic DNA was purified using the DNeasy Blood & Tissue DNA purification kit (QIAGEN). In parallel ...
-
bioRxiv - Molecular Biology 2022Quote: ... the nuclear pellet was sonicated for 5 min and genomic DNA was extracted using the QIAamp DNA Mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Metagenomic sequencing libraries were constructed from extracted DNA samples with 10 μL (1/5 volume) reactions using the QIAseq FX DNA Library Kit (QIAGEN). Each metagenomic sequencing library was sequenced using the Illumina NextSeq 2000 System 2 x 150 bp configuration.
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from the bacterial strains grown in VL55 medium with 5 mM pyruvate using the Qiagen Genomic-tip 100/G DNA isolation kit and associated DNA buffers (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Genomic DNA Extraction and Purification: Genomic DNA was extracted from 5 M cells using the Gentra Puregene Cell Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... paired-end (37:8:8:38) RNA-sequencing using a RNeasy Micro kit (Qiagen #74004) for RNA extraction ...
-
bioRxiv - Genetics 2021Quote: Relative telomere length of MDS patients was measured by quantitative polymerase chain reaction (qPCR) as previously reported.8 K562 cell DNA was extracted using the QIAamp Blood Mini kit (Qiagen). Telomere length was measured by two orthogonal methods ...
-
bioRxiv - Microbiology 2023Quote: ... an unbiased amplification method was employed by amplifying the purified DNA at 30°C for 8 hours using a REPLI-g Single Cell kit (Qiagen). The amplified DNA was purified using AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... Liquid cultures or swabs from agar plates from selected bacterial strains (Supplementary Data 3) were used to extract DNA using the QiAmp Micro DNA kit (Qiagen, Hilden, Germany). The extracted DNA was treated with RNase ...
-
bioRxiv - Physiology 2019Quote: ... DNA was extracted from 5 µL of RBCs using the Gentra Puregene Tissue Kit (Qiagen) and kept frozen at −80°C until analysis ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted from 5 × 106 cells using Qiagen DNeasy Blood & Tissue Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... 3-5 million cells were then harvested and genomic DNA was isolated using QIAamp DNA mini kit (QIAGEN, prod. number 51304). The following L1 recovery steps were adapted from24,52 with modifications ...
-
bioRxiv - Genomics 2020Quote: ... 25 nuclei were sorted into each well of 96-well plates (8-10 plates per experiment) containing 12 µl of nuclear lysis buffer (11 µl of EB buffer (Qiagen) supplemented with 0.5 µl of 100X BSA and 0.5 µl of 1% SDS) ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was prepared from approximately 5×106 cells using the DNeasy-96 kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 8×105 cells with the RNeasy mini kit (Qiagen) in combination with the QIAshredder system (Qiagen ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5mM EDTA (pH 8) together with a 5 mm stainless steel bead (Qiagen) and macerated at 1,200 rpm for 2 mins in the Geno/grinder followed by a 10-minute centrifugation (17,000 x g ...
-
bioRxiv - Immunology 2021Quote: ... Plates contained 5 µl of TCL lysis buffer (Qiagen) supplemented with 1%β-mercaptoethanol ...
-
bioRxiv - Microbiology 2023Quote: ... Colonies were picked onto fresh plates and genomic DNA extraction was carried out using the QIAamp® DNA Mini Kit (QIAGEN; cat. number: 51306) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: DNA was isolated from 10-20 8-μm frozen tissue sections of biopsies from humanized mice using the PureGene DNA isolation kit (Qiagen, Hilden, Germany). PCR was performed with six framework region 1 subgroup specific primers and a JH primer mix (3’ JH mix ...
-
bioRxiv - Microbiology 2022Quote: Fecal samples were collected from the Duroc piglets at 60□±□8 days of age and microbial DNA was extracted with the DNeasy PowerSoil Kit (QIAGEN, Hilden, Germany). Extracted DNA was sent to the University of Illinois Keck Center for paired-end (2□×□250 bp ...
-
bioRxiv - Genomics 2022Quote: ... we extracted DNA with Qiagen high molecular weight DNA kit (MagAttract HMW DNA Kit - Qiagen). For the toe pads ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted by using commercial DNA extraction kit (QIAamp DNA-Mini Kit; (Qiagen®). The Qubit™ dsDNA BR Assay kit (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was isolated from Cac-P4.5 cells (originating from the PtP4.5 selection plate) using the MagAttract HMW DNA Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Worms were washed from each plates and genomic DNA was extracted using Qiagen DNeasy Blood & Tissue Kit (Qiagen) and quantified by Qubit (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2023Quote: Genomic DNA was isolated from Streptomyces plates or liquid cultures using the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Germany). The bead beating was performed using a TissueLyser LT (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... Genomic DNA (gDNA) was extracted from 1-5×106 cells using DNeasy Blood and Tissue Kit (Qiagen) and 250 ng gDNA ...
-
bioRxiv - Synthetic Biology 2021Quote: mESC gDNA was purified from 1-5 million cells using the QIAamp DNA mini kit (Qiagen 51306) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: DNA was extracted from the donors’ peripheral blood (5 ml) using DNeasy Blood & Tissue Kit from QIAGEN according to the manufacturer’s protocol ...