Labshake search
Citations for Qiagen :
1 - 50 of 1121 citations for Cytosolic arginine sensor for mTORC1 subunit 2 CASTOR2 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tag ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse penta-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Immunology 2024Quote: ... Total cytosolic DNA was extracted using a DNeasy Blood & Tissue Kit (QIAGEN) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... and HRP–conjugated anti Penta-His antibody (Qiagen). Other chemicals used in this study were of an analytical grade or higher ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies (α-His HRP conjugated (Qiagen 34460) or α -VSV-G (Millipore sigma V4888-200UG) ...
-
bioRxiv - Neuroscience 2020Quote: ... or RNeasy Mini Kit (synaptosome and cytosolic fraction from homogenized mouse forebrain; Qiagen). For RT-PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted from total cell lysate and cytosolic fractions using DNeasy kit (Qiagen). DNA samples were each diluted 1:10 and corresponding primers (Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was then extracted from the cytosolic fraction using the QIAquick Nucleotide Removal kit (QIAGEN) and from the whole cell fraction using the QIAamp DNA Mini Kit (QIAGEN) ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA from cytosolic and nuclear fraction were extracted using the RNeasy Mini Kit (Qiagen).
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was extracted from equal amounts of cytosolic fractions using QIAquick Nucleotide Removal kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The cytosolic supernatant was incubated and stirred with 1 ml Ni-NTA agarose (Qiagen, Hilden, Germany) at 4 °C for 1 h ...
-
bioRxiv - Biophysics 2020Quote: ... anti-His antibodies from the Penta-His HRP Conjugate Kit (Qiagen) were used.
-
bioRxiv - Biochemistry 2022Quote: ... anti-His antibodies from the Penta-His HRP Conjugate Kit (Qiagen) were used ...
-
bioRxiv - Microbiology 2020Quote: ... An anti·His antibody conjugated to horseradish peroxidase (Penta·His HRP Conjugate, Qiagen) was used to detect 6xHis-tagged proteins ...
-
bioRxiv - Cell Biology 2023Quote: DNA was isolated from 200 μL of the cytosolic fraction using a DNeasy Blood & Tissue Kit (Qiagen). Quantitative PCR was employed to measure mtDNA using Applied Biosystems SYBR Green Master Mixes (Agilent Technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... A Western blot on nitrocellulose using a PentaHis Antibody HRP conjugate (Qiagen) produced a positive result for the band identified as NONO ...
-
bioRxiv - Genomics 2020Quote: ... RNA was extracted from the nuclear and cytosolic fractions of the embryos in different stages as explained before using the RNeasy mini kit from QIAGEN and DNase (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... an anti GAPDH monoclonal antibody (SC-47724) or an anti RGS HIS6 HRP (QIAGEN). When necessary ...
-
bioRxiv - Microbiology 2021Quote: ... tularensis IM protein SecY (Huntley, 2007) or the Penta-His HRP conjugate antibody (Qiagen).
-
bioRxiv - Cell Biology 2022Quote: ... Binding of Ad2 was detected by an HRP-conjugated monoclonal antibody to His-tag (Qiagen) expressed by the fiber knob ...
-
bioRxiv - Microbiology 2023Quote: ... and were probed with either horseradish peroxidase (HRP)- conjugated primary antibodies against His-tag (Qiagen) or with rabbit primary antibodies against HA-tag (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... membranes were incubated under soft shaking with Penta-His antibody (Penta His HRP Conjugate; Qiagen) for 1 h with 0.5 % (w/v ...
-
bioRxiv - Microbiology 2024Quote: ... His-tagged proteins were detected with a mouse anti-His HRP-conjugated antibody (1:3000) from Qiagen. MBP fusion proteins were detected with a rabbit anti-MBP from NEB company 1:1000 followed by an incubation with a goat anti-rabbit HRP-conjugated (1:3000) ...
-
bioRxiv - Biochemistry 2020Quote: Cells (200,000 for HeLa and hiPSC-CMs and 500,000 for NRCMs) were seeded on glass cover slips and transfected with sensor plasmids using Effectene (Qiagen) (HeLa ...
-
bioRxiv - Microbiology 2024Quote: ... the membrane was blocked in Anti·His HRP Conjugate blocking buffer (Penta·His HRP Conjugate, Qiagen) at 4 °C overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µL from the supernatant and cell lysates were applied on a nylon membrane and two different antibodies (an HRP-conjugated anti-His tag from Qiagen and an HRP-conjugated anti-strep tag from Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... along with the human NaV β1 and β2 subunits (2 μg total plasmid DNA was transfected with a cDNA ratio of 10:1:1 for NaV1.X:β1:β2 subunits) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.). Human β1 and β2 cDNAs were cloned into plasmids encoding the CD8 receptor (CD8-IRES-hβ1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transiently co-transfected with NaV1.2 and the accessory β1 and β2 subunits (2 μg total plasmid DNA was transfected with a cDNA ratio of 10:1:1 for NaV1.2:β1:β2 subunits) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.). Human β1 and β2 cDNAs were cloned into plasmids encoding the CD8 receptor (CD8-IRES-hβ1 ...
-
bioRxiv - Biophysics 2021Quote: ... 2 g/ml Biotinylated Anti-His Antibody (Penta-His Biotin Conjugate; Qiagen; No. 34440) in T50 buffer was introduced into flow cells at 50 μl/min ...
-
Targeting properdin - Structure and function of a novel family of tick-derived complement inhibitorsbioRxiv - Immunology 2021Quote: ... the Penta-His HRP Conjugate Kit (Qiagen) was used following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... The Penta-His HRP Conjugate Kit (Qiagen) was used for detection of His-tagged proteins according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... we used anti RGS HIS6 HRP(QIAGEN) Cat.n°/ID 34450.
-
bioRxiv - Immunology 2021Quote: ... and HRP-anti-His (Penta-His Ab, Qiagen) was used in the detection step ...
-
bioRxiv - Biophysics 2024Quote: ... or anti-His6X (His HRP conjugate by Qiagen) antibodies at a 1:1,000 dilution ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a Penta His HRP conjugate was used (Qiagen). A Goat anti-Rabbit IgG (H+L ...
-
bioRxiv - Microbiology 2021Quote: ... 1:1,000 dilution of α-His-HRP antiserum (Qiagen), or 1:1,000 dilution of α-OmpA antiserum (Antibody Research Corporation ...
-
bioRxiv - Plant Biology 2024Quote: ... His-tag (Penta-His HRP Conjugate, ID 34460, Qiagen), Actin (A0480 ...
-
bioRxiv - Biochemistry 2021Quote: Penta-His HRP conjugate was purchased from QIAGEN (Hilden, Germany). Anti-BepA (Narita et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... bound His-mSTIC2 protein was detected by anti His HRP conjugate (Qiagen) and ECL reaction (Pierce).
-
bioRxiv - Synthetic Biology 2020Quote: ... For SARS-CoV-2 antigen detection the blots were incubated with 1:2000 Anti-His mouse monoclonal primary antibody (Qiagen, #34660) and then incubated with 1:10000 peroxidase labelled anti-mouse IgG secondary antibody (GE Healthcare) ...
-
bioRxiv - Cell Biology 2024Quote: ... dynamin 2 (Qiagen), CDC42 (Dharmacon) ...
-
bioRxiv - Microbiology 2020Quote: ... Western blot analysis was performed using the Penta His HRP conjugate kit (Qiagen). To check for equal loading ...
-
bioRxiv - Biochemistry 2022Quote: ... The affitin detection was carried out using the RGS-His6-HRP conjugate (QIAGEN).
-
bioRxiv - Microbiology 2021Quote: ... a penta-His HRP conjugate was used (1:4000, QIAGEN GmbH, Hilden, Germany). The detection of GFP was performed with the primary antibody anti-GFP (1:10000 ...
-
bioRxiv - Biochemistry 2022Quote: ... The detection of binding was carried out by the RGS His6 HRP conjugate (QIAGEN) that detects the RGS His6 motif present in the affitins N-terminal ...
-
bioRxiv - Plant Biology 2022Quote: ... Blocking of the membranes was performed in anti His HRP conjugate blocking buffer (Qiagen). After blocking at room temperature for 2 h ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...