Labshake search
Citations for Qiagen :
101 - 150 of 734 citations for Cytochrome C Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... All recombinant vectors were grown in XL1-Blue competent cells and extracted using QIAprep Spin Miniprep kit (Qiagen, Germany) according to manufacturer instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant proteins were purified to near homogeneity (>95%) using Ni-chelate affinity chromatography on Ni-NTA Superflow resin (Qiagen) using standard protocols ...
-
bioRxiv - Genomics 2019Quote: ... and stored at −20°C until midiprepped (Qiagen) according to the manufacturer’s protocol.
-
bioRxiv - Genomics 2022Quote: ... 4°C) and stored at −80°C before metagenomic extraction using the DNeasy PowerSoil kit following manufacturer specifications (QIAGEN, Hilden, Germany). All sampling and sample processing was conducted following cold chain principles ...
-
bioRxiv - Synthetic Biology 2024Quote: ... of Gibson Assembly reaction mix was added to NEB Stbl cell (C3040) for transformation and grown at 30°C or 37°C for the plasmid DNA preparation (Qiagen miniprep). The resulting plasmids were sequence-verified using Sanger sequencing (Genewiz).
-
bioRxiv - Microbiology 2021Quote: Recombinant protein was blotted with anti-His antibody using the same method: 1:2000 mouse anti-tetra-His IgG (Qiagen); 1:1500 goat anti-mouse IgG-HRP (Dako) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The expression construct was transformed into DH10MultiBacY cells and recombinant bacmid was purified with a QIAprep Spin Miniprep Kit (Qiagen). V0 and V1 virus generation was performed using SF9 cells as previously described 44 ...
-
bioRxiv - Cell Biology 2021Quote: ... The lysate was cleared via centrifugation and recombinant PfCen3-6xHis were purified from the soluble fraction using Ni-NTA agarose beads (QiaGen) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: ... 6XHis tagged-Trx1 and Trr1 recombinant proteins were cloned in PET24 vectors and purified by column affinity onto Ni-NTA beads (Qiagen). The precursor was imported in 50 μg of the indicated yeast mitochondria in the presence of 2 mM ATP and 2.5 mM NADH at 30°C ...
-
bioRxiv - Biochemistry 2022Quote: ... as previously described.10 Detection of 6x His-tagged recombinant POLIB variants was performed with primary antibody Penta•His (1:1000, Qiagen) for one hour ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting 6xHis-tagged expression constructs were utilized to generate recombinant enzymes that were purified via Ni-NTA agarose (Qiagen). IDS enzyme assays were carried out in triplicate as previously described [45] ...
-
bioRxiv - Physiology 2021Quote: ... We infected Sf9 cells with the recombinant virus to express and purify the His-tagged proteins using a nickel-nitrilotriacetic acid (Ni-NTA, Qiagen) column ...
-
bioRxiv - Microbiology 2020Quote: ... cells were either left untreated or treated with 1000 IU/ml recombinant IFN-α treatment and incubated for 6 h or transfected overnight with polyI:C (10 μg/ml) using Polyfect (Qiagen). Luciferase assays were carried out ...
-
bioRxiv - Molecular Biology 2023Quote: ... the large stocks of recombinant T/F LTR-pGL3 reporter plasmids were generated using Plasmid Maxi kit (Qiagen, Valencia, CA) for immediate use or longer storage at -80 °C.
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding the recombinant RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). On Day 0 ...
-
bioRxiv - Biophysics 2023Quote: ... coli strain M15-[pREP4] (for transformation of recombinant plasmids) and RNAse (for protein purification) were purchased from Qiagen (Valencia, CA). All other chemicals were obtained from Sigma-Aldrich (St ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant protein was partially purified by affinity chromatography on nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com). Purification steps were carried out as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Serum was stored at −80°C as well as tissue samples were stored at −80°C or in RNAlater (Qiagen, Hilden, Germany) at −20°C.
-
bioRxiv - Plant Biology 2022Quote: Total root RNA was extracted from plantlets grown in vitro at 22 °C and 10 °C using the RNeasy®Plant Mini Kit (QIAGEN, Germany). One microgram of total RNA was reverse transcribed using an oligo(dT)20 primer and the Super Script™ IV RT (lnvitrogen,USA ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCOs were stored at -80°C in RNAlater (Qiagen) until library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... and further disrupted by TissueLyser II (QIAGEN, C.0659). 100 mg ground sample was first resuspended in 1 mL lysis buffer (1×PBS ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted from the allantoic fluid of recombinant and wild type after the first and fifth passages in eggs using the QIAamp® Viral RNA Mini Kit (Qiagen). The real-time qRT-PCR was performed using SuperScript™ III Platinum™ One-Step qRT-PCR Kit to detect NDV M gene41 ...
-
bioRxiv - Biophysics 2020Quote: ... Bacterial extracts were prepared as described46 and the recombinant protein was purified using an Ni-NTA Superflow cartridge (Qiagen, Hilden, Germany) and eluted with imidazol47 ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid was transfected to 293T cells and the recombinant S protein trimers were purified by Ni-NTA (nickel-nitrilotriacetic acid) chromatography (QIAGEN, Germany), followed by size exclusion to further purify the trimers ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The recombinant plasmid was then purified at a high concentration (200 μg/mL) using the plasmid preparation kit (Qiagen, Germantown, MD).
-
bioRxiv - Immunology 2024Quote: ... Genomic DNA from the pooled recombinants and parent strain were isolated using the Gentra® Puregene® DNA isolation kit (Qiagen) and sent for whole genome sequencing (BGI) ...
-
bioRxiv - Immunology 2021Quote: ... Following the manufacturer’s instructions RNA was reverse-transcribed in a 20 μl reaction volume (42°C, 30 min; 95°C, 5 min) using a QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). cDNA was then amplified using a SYBR Green I Master mix (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was prepared from day one adult animals raised at 25°C or 20°C by using RNeasy® Mini Kit (Qiagen, Venlo, The Netherlands). endu-2(tm4977 ...
-
bioRxiv - Microbiology 2020Quote: The RNA genomes of recombinant MeV in P2 or P10 were isolated from infected Vero cells using the QIAamp Viral RNA Mini Kit (QIAgen, Hilden, Germany) according to the manufacturer’s instructions and resuspended in 50 μL RNase-free water ...
-
bioRxiv - Microbiology 2022Quote: The recombinant His-TvFACPα full-length protein was produced and purified by a standard protocol as suggested by the supplier (QIAGEN, Hilden, Germany) (48 ...
-
bioRxiv - Genetics 2021Quote: ... The final constructs were transformed into BL21 (DE3) for expression and recombinant Fur/mFur proteins were purified using Ni-NTA agarose (Qiagen, California, USA). The proteins induced by the addition of 1 mM IPTG at 16°C for 12 h ...
-
bioRxiv - Immunology 2020Quote: ... were either frozen at −80°C in RLT buffer (Qiagen) for future RNA extraction or snap frozen using O.C.T.™ and preserved at −80°C ...
-
bioRxiv - Plant Biology 2020Quote: ... coli cells grown overnight at 30°C (Plasmid Mini Kit, QIAGEN), and its concentration measured by nanodrop ...
-
bioRxiv - Genetics 2021Quote: ... Tissue was lysed at 55°C in Cell Lysis Solution (Qiagen) containing Proteinase K (Qiagen) ...
-
bioRxiv - Biophysics 2021Quote: ... at 20°C overnight and purified using Ni-NTA agarose (Qiagen) followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... three of which were stored at −80 °C in PowerFecal (Qiagen) 2 mL screw-cap bead tubes until ready for DNA extraction (within 1-3 months) ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4 and stored at −20 °C in RNAlater solution (Qiagen). RNA was extracted using RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... or DNAse (200 Units well−1, 1 hr, 37°C, Qiagen). DAPI was stained at 0.5 μM (5 mins ...
-
bioRxiv - Microbiology 2022Quote: ... at −80 °C using the RNeasy plus Mini Kit (Qiagen, 74134) according to the manufacturers protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... or Ni-NTA agarose column (Qiagen, for 6XHis-EIN2-C purification) according to manufacturer’s menu followed by sonication ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... coli C mutants was extracted using DNeasy Blood & Tissue kit (Qiagen). Quality of extracted DNA was confirmed before sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... Plant samples were homogenized at -80 °C in a TissueLyser (Qiagen) and resupendend in a 10-fold excess of 80% (w/v ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... overnight at 37 °C and purified by a PCR purification kit (Qiagen). Subsequently ...
-
bioRxiv - Neuroscience 2020Quote: ... at −80°C until RNA extraction using the RNeasy Mini Kit (Qiagen). RNA quality was determined using the RNA nano assay on a 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA samples were stored at -20°C in AE buffer from Qiagen DNeasy Plant Mini Kit.