Labshake search
Citations for Qiagen :
501 - 550 of 10000+ citations for Cyclic GMP Direct ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and 5 mm diameter stainless steel beads (QIAGEN) were added to each sample pool ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... and 5-mm stainless-steel beads (Qiagen #69989) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL Proteinase K (20 mg/mL, Qiagen) and 100 µl 10% SDS (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... in 5-ml polypropylene columns (no. 34964; Qiagen), washed with 50 mM Na2HCO3 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and 5-mm stainless steel beads (Qiagen #69989). RNA purification was performed using the NucleoSpin RNA kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2021Quote: ... in a 5 ml tube (Qiagen, DNAse/RNAsefree). The sediment samples were kept at 4 °C until the next day and then stored at −80 °C ...
-
bioRxiv - Immunology 2020Quote: ... 5×106 PBMCs were resuspended in RLT (Qiagen) and incubated at room temperature for 10 min prior to storage at –80°C ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Physiology 2020Quote: ... with 5 mm beads in RLT buffer (Qiagen) containing 1% β-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... + 5% beta-mercaptoethanol using a bead mill (Qiagen). Samples were heated at 95° for 5 minutes to denature proteins ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5 mm diameter stainless steel beads (Qiagen) and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of 2U/μL Turbo DNase (Qiagen), and 1 μL of 10 mg/mL RNase A (Qiagen) ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM primers and 1 μl DNA template ...
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM Primer and 1 μl DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl Polyfect Transfection Reagent (Qiagen, catalog # 301105) was added ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 mm stainless steel beads (Qiagen, #69989). Lysates were incubated for 2 h at 37°C protected from light ...
-
bioRxiv - Immunology 2021Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μL of 0.1 M glycine-HCL buffer pH 2.7 ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplification was performed in 384-well pick&mix plates (Qiagen) with customized selection of 192 LNA-enhance primers to detect 187 endogenous microRNAs and 5 spike-in controls per sample ...
-
bioRxiv - Immunology 2021Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μl of 0.1 M glycine-HCL buffer pH 2.7 ...
-
bioRxiv - Immunology 2020Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum ...
-
bioRxiv - Immunology 2020Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μl of 0.1 M glycine-HCL buffer pH 2.7 ...
-
bioRxiv - Physiology 2022Quote: Cells were lysed directly in the plate using Buffer RLT (Qiagen) with 10uL/mL 2-mercaptoethanol following a quick PBS rinse ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plate was then processed in the PyroMark Q24 pyrosequencer (Qiagen). Results were analyzed with PyroMark Q24 Advanced 3.0.1 software ...
-
bioRxiv - Immunology 2023Quote: ... RT qPCR was conducted with custom array plates (330171, Qiagen, Canada) using the LightCycler 480 Real-Time PCR system (Roche Molecular Systems Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... and a 96-well PowerMag Glass Bead plate (Qiagen, Hilden, Germany). The Glass Bead Sterilizer was turned on ...
-
bioRxiv - Molecular Biology 2024Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μl of 0.1 M glycine-HCl buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Immunology 2022Quote: ... The middle and inferior right lobes were weighted and homogenized with PBS (1:5 w/v) using a 5 mm stainless steel bead (Qiagen, USA) and a TissueLyser LT (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Genomics 2019Quote: In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 0.1 g of tissue per 1 mL of PBS was homogenized with stainless steel beads of 5 mm (25–30 Hz for 5 min) by a Tissuelyser (Qiagen, Venlo, Netherlands). The homogenates were centrifuged at 10,000 x g for 10 min and the supernatant was collected and stored at −80 °C until CD quantification ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... we added a 5-mm stainless steel bead (QIAGEN) and 100 μl of PBS to each tube and lysed the samples by TissueLyser II (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... 5 µL Proteinase-K (20 mg ml-1, Qiagen) was added to the solution and incubated at 60°C for 30 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μg total RNA was treated with DNase (Qiagen) and purified (RNeasy Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... A single sterile 5 mm stainless steel bead (Qiagen) was added to each tube ...
-
bioRxiv - Neuroscience 2022Quote: ... and added 5 volume PB including pH-indicator (Qiagen) and 200 μL sodium-acetate (3M ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 µl Hot Start Polymerase (Qiagen, 5 U/ µl), 20 ng/µl DNA template (95°C for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... siWDR1 (5’-GGTGGGATTTAGGCAATTATT) and AllStars Negative Control siRNA (Qiagen).
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... A 5 ml Strep-tactin Superflow Plus column (Qiagen) was equilibrated with 50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... with a 5 mm diameter stainless steel bead (Qiagen) for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations ...
-
bioRxiv - Genomics 2021Quote: ... then 24 mL buffer PB (5:1, Qiagen #19066) and 1.2mL NaOAc were added sequentially ...
-
bioRxiv - Genomics 2021Quote: ... 5 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a 5 mm stainless steel bead (Qiagen #69989) in an RNase-free microcentrifuge tube ...