Labshake search
Citations for Qiagen :
451 - 500 of 662 citations for Chondroitin Sulfate Proteoglycan 4 CSPG4 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and the chromatin incubated at 67 °C for 4 h following a purification step with the QIAquick PCR Purification kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... beads were discarded and the supernatant containing reconstituted into ND A2AAR was incubated for 4 h with 250 µL of Ni-NTA resin (Qiagen) for separating from empty ND ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was isolated from fecal matter and gastrointestinal sections using the DNeasy HTP 96 PowerSoil Kit (Qiagen, 12955-4). All DNA was recovered in ultrapure water without additives and stored at −20 °C.
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Biochemistry 2023Quote: ... Filters were incubated at 55°C for approximately 4 h and the resulting lysates were purified with the DNeasy kit (Qiagen) using a slightly modified protocol49 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Developmental Biology 2023Quote: ... Supernatants were separated from lysates and incubated with affinity beads at 4°C overnight (His beads: Ni-NTA from QIAGEN; GST beads ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from the hippocampus of P65 females of all four groups (n=4/group) using the RNeasy Midi Kit (Qiagen). RNA samples were submitted to the University of Minnesota Genomics Center for library preparation and sequencing ...
-
bioRxiv - Bioengineering 2023Quote: Genome DNA was extracted from each cell line every 3 – 4 days after transfection or transduction using DNeasy Blood and Tissue Kit (QIAGEN) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Template DNA was degraded using RQ1 DNAse for 30 min at 4°C and RNA was purified using RNAeasy mini kit (Qiagen). 4-week-old NRG mice were injected intra-hepatically using 10 µg of RNA in a maximum volume of 50 µL of PBS+RNA and one week post injection a terminal bleed was performed ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The remaining cells were pelleted at 1000 x g for 10 minutes at 4°C and lysed in 350 µL of Buffer RLT (Qiagen) supplemented with 3.5 µL of 2-β mercaptoethanol (#444203 ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1.5 h in 50 mL conical tubes ...
-
bioRxiv - Biochemistry 2023Quote: A kinome-wide siRNA library that contained 4 individually arrayed siRNA sequences in 384-well plates was purchased from Qiagen. The library consisted of known kinases and associated proteins ...
-
bioRxiv - Microbiology 2023Quote: ... Sample DNA was extracted from microbiome samples using the PowerSoil DNA extraction kit (Cat. No. 12955-4, Qiagen, Valencia, California). Marker genes in isolated DNA were polymerase chain reaction (PCR)-amplified using GoTaq Master Mix (Cat ...
-
Sweetwater: an underrated crude glycerol for sustainable lipid production in non-conventional yeastsbioRxiv - Systems Biology 2023Quote: ... tubes were vortexed for 15 s and submitted to cell disruption for 15-min at 4°C using a TissueLyser II (Qiagen) at 30 Hz ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were selected in puromycin (1 μg/ml) the next day and after 4 days genomic DNA was extracted using DNeasy Blood and Tissue kit (Qiagen). Genomic DNA was sonicated to an average size of 500 bp using S2 Focused-ultrasonicator (Covaris ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplicons were size-verified on a 4% agarose gel and PCR amplicons were extracted and purified (Qiaquick Gel Extraction Kit, Qiagen) before indexing (Nextera XT ...
-
bioRxiv - Pathology 2023Quote: ... tissue and cells were lysed in RIPA lysis buffer supplemented with orthovanadate and a cocktail of protease inhibitors at 4°C (using a TissueLyser (Qiagen) to homogenize liver tissue ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1 h in 50 mL conical tubes ...
-
bioRxiv - Microbiology 2023Quote: ... Lysates were centrifuged for 30 min at 38,000 g and 4°C and cleared supernatants loaded onto Ni-NTA columns with 0.5 mL bed volume (1018244 Qiagen, Germany). The columns were washed sequentially with 3 column volumes (CV ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting samples were supplemented with 300 mM NaCl and 10 mM imidazole and incubated overnight at 4 °C on a stirring wheel with 50 µl Ni-NTA agarose resin slurry (QIAGEN) pre-equilibrated with wash buffer I (50 mM Tris-HCl pH 7.8 ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then samples and inputs were incubated for 4 hr at 37°C with 1.5 µl of 10 mg/ml RNase A (Qiagen, 1007885) and 15 µl 10% sodium dodecyl sulfate and 3.5 µl 20 mg/ml Proteinase K (Thermo Fisher ...
-
bioRxiv - Genetics 2024Quote: ... PCR was performed with 2 µL (∼16 ng) or 4 µL (∼32 ng) of BT-converted DNA with HotStar Taq Polymerase (Qiagen), depending on the genomic region ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from ten 4-mL aliquots of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104).
-
bioRxiv - Pathology 2024Quote: ... by running one homogenization cycle (50 Hz oscillation frequency (50 cycles/s) for 4 minutes) in a Tissue lyser LT (Qiagen). Tubes were then centrifuged at 5000 rpm for 5 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Immunology 2024Quote: ... Cytosolic fractions were prepared by centrifugation at 10,000 × g for 30 min at 4°C and DNA was isolated from them using the DNeasy Blood & Tissue kit (Qiagen). The copy number of mitochondrial DNA encoding 16S RNA (RNR2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the supernatant was added to a 500 μl equilibrated Glutathione Sepharose 4 Fast Flow affinity medium (GE) or Ni-NTA agarose (Qiagen). The lysate was incubated with an affinity matrix for 1 hour at 4 ⁰C ...
-
bioRxiv - Genomics 2024Quote: ... Digested product was then run on a 4% agarose gel with 1x SYBR Safe for 45 minutes at 100 V and gel extracted (Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... Lysates were centrifuged for 30 min at 30000 x g in 4 °C and the resulting supernatants were gently mixed with Ni-NTA Agarose beads (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... Lysed cells were sedimented by centrifugation at 20,000 RCF at 4 °C for 30 min and the lysate was subsequently loaded onto pre-equilibrated Ni-NTA agarose resin (Qiagen) at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... The cell pellet was removed after centrifugation (16000 rpm, 4 °C, 1 h) and supernatant was loaded into a Ni-NTA agarose column (Qiagen). Protein was eluted in an elution buffer (50 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2024Quote: ... Total RNA was extracted from the supernatant (12,000 x g for 10 min at 4°C) of centrifuged tissue homogenate using an RNeasy Mini Kit (Qiagen, USA). The extracted total RNA was used for single-strand cDNA synthesis ...
-
bioRxiv - Genomics 2024Quote: ... Fosmid clones from the WIBR-1 library were purchased from the BACPAC Resources Center (for coordinates and names, see Supplementary Table 4) and isolated using Large-Construct Kit (Qiagen).
-
bioRxiv - Biophysics 2020Quote: ... functionalized with neutravidin and treated with biotinylated anti-hexahistidine monoclonal antibody (Qiagen) as described (15) ...
-
bioRxiv - Biochemistry 2021Quote: ... Electroblotted membranes were incubated with penta-His antibody (Qiagen, Valencia, CA, USA). The antigen–antibody complex was visualized with alkaline phosphatase-linked to anti-rabbit IgG followed by staining with 5-bromo-4-chloroindol-2-yl phosphate and nitro blue tetrazolium [36].
-
bioRxiv - Microbiology 2021Quote: ... The followed antibodies and dilutions were used: Strep 1:1000 (Qiagen, 34850), PAF1 1:1000 (Bethyl Labs #A300-173A) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Biophysics 2020Quote: ... the surface was incubated with 1 nM biotinylated penta-His antibody (Qiagen) in buffer A for 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... The primary and secondary antibodies used were anti-penta His (Qiagen #34660) and goat anti-mouse IgG (LiCOR #926-68070 ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tag ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse penta-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Biochemistry 2021Quote: ... resuspended in 100 μL PBS containing 0.1 μg anti-penta·His antibody (Qiagen) and 1 μg streptavidin allophycocyanin (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... and immunoblotted using a mouse monoclonal antibody against Strep-tag (Qiagen, 34850). Alkaline phosphatase conjugated to anti-mouse IgG (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: Mouse antibody genes were amplified using HotstarTaq DNA polymerase (Qiagen Cat # 203209) with the primer sets specific for the IghIOMAiGL and IgkIOMAiGL transgenes ...
-
bioRxiv - Biochemistry 2023Quote: ... a conjugate of mouse monoclonal penta-His antibody and horseradish peroxidase (Qiagen) was used ...