Labshake search
Citations for Qiagen :
551 - 600 of 10000+ citations for Ceruloplasmin Colorimetric Activity Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were harvested from 24-well plates in 350μL RLT Plus (Qiagen) supplemented with 1% beta-mercaptoethanol after an 8-hour induction with 10nM E2 or DMSO ...
-
bioRxiv - Microbiology 2019Quote: ... each plate contained the same amount of the following siRNAs from Qiagen as knockdown controls ...
-
bioRxiv - Plant Biology 2020Quote: ... Initial hits were further optimized in 24-well sitting-drop plates (Qiagen) using as reservoir solution 18-22 % PEG 3350 ...
-
bioRxiv - Genetics 2020Quote: ... the deepwell plates were filled with the following reagents: wash buffer (Qiagen), 80% Ethanol ...
-
bioRxiv - Immunology 2020Quote: ... Plates were spun down and cell pellets were resuspended in Qiazol (Qiagen) for RNA extraction ...
-
bioRxiv - Neuroscience 2023Quote: ... the deepwell plates were filled with the following reagents: wash buffer (Qiagen), 80% Ethanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... in 96-well plates or a Rotor-Gene Q (Qiagen, Hilden, Germany) in 4-tube strips.
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... were homogenized in 2-mL tubes containing lysis buffer plus 1% 2-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless-steel beads (Qiagen #69989 ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...
-
bioRxiv - Physiology 2023Quote: ... the RNAs from livers (n = 2 mice/group, each group contains RNAs pooled from 2 mice) were prepared (RNeasy, Qiagen). Ribosomal RNA was removed with the Ribozero HMR Gold kit (Illumina).
-
bioRxiv - Genomics 2020Quote: ... cells were mixed 1:2 with RNAProtect (Qiagen) and harvested via centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... Samples were treated with 2 µg RNaseA (Qiagen) and DNA was purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... 2) purifying twice using gDNA-eliminator columns (QIAGEN) before and after DNase treatment followed by RNeasy column purification (QIAGEN) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Mm Aldoa 2 FlexiTube siRNA (Qiagen, SI00896238) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: 2 mL of Ni-NTA resins (Qiagen, USA) were packed into a 5 mL column ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Immunology 2023Quote: ... 2 ml of Ni-NTA Agarose (Qiagen, 30310) was added per 50 ml of supernatant and the mix was left on a rolling platform at 4°C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... with Negative Control GapmeR A (30300019-2, Qiagen) using 3.5 μl of Lipofectamine 2000 in Opti-MEM I reduced serum medium following the manufacturer’s suggested protocol ...
-
bioRxiv - Immunology 2024Quote: 2 ml MaXtract High Density tubes (Qiagen, 129056) were centrifugated at 12,000–16,000 × g for 20-30 second centrifugation ...
-
bioRxiv - Cell Biology 2020Quote: ... in the wells of 6 well plates (35mm) using Effectene transfection reagent(Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... plates containing a single steel grinding bead in each well (Qiagen, cat# 69989). Eleven plates in total were prepared for 965 individual gDNA extractions ...
-
bioRxiv - Neuroscience 2021Quote: Cytokine secretion assays were performed using Human Multi-Analyte ELISArray plate (Qiagen CMEH6321A). IL1β ...
-
bioRxiv - Biochemistry 2022Quote: ... Surviving colonies from selective plates were picked as single colonies for miniprep (Qiagen) followed by Sanger sequencing to verify the identities of the mutated amino acids.
-
bioRxiv - Genetics 2020Quote: DNA was extracted using the BioSprint automated extraction protocol in plate format (QIAGEN), using a proteinase-K digestion and an RNase incubation to reduce RNA presence in genomic DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... miRCURY LNA miRNA Custom PCR Panels 96-well plates were ordered from Qiagen. These ready-to-use plates contained specific primer sets pre-coated in the wells ...
-
bioRxiv - Microbiology 2021Quote: ... with bead beating in Qiagen Powerbead Pro plates (Cat No. 19311, Qiagen, Germany). Extracted DNA was quantified using the Quant-iT PicoGreen dsDNA Assay kit (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: 96-well plates of cells were directly homogenized in 100μL RLT buffer (Qiagen) containing 10μL/mL beta-mercaptoethanol and allowed to incubate on an orbital shaker for 10 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... Transfections were carried out in 12-well plates using Effectene transfection reagent (Qiagen). Unless otherwise indicated (for gradient experiments) ...
-
bioRxiv - Biochemistry 2023Quote: ... 25 %(w/v) PEG 2000 MME from PEGs I suite screening plate (Qiagen). Then ...
-
bioRxiv - Genomics 2023Quote: ... Colonies were allowed to grow overnight on Carbenicillin plates and midiprepped (Qiagen, 12945). We collected approximately 1.2 million colonies ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Crystals were grown at 4 °C in EasyXtal-15-Well Tools plates (Qiagen), using hanging-drop vapour diffusion ...
-
bioRxiv - Immunology 2023Quote: ... Remaining B cells were lysed and mRNA was extracted using TurboCapture plates (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... The reaction was run in the QIAcuity Nanoplate 26k 24-well plates (QIAGEN). The 40 µl reaction mix consisted of 10 µl of 4x QIAcuity Probe PCR Kit (QIAGEN) ...
-
bioRxiv - Immunology 2019Quote: ... approximately 25 mg of tissues were homogenized in 2 mL tubes containing 600 μL of Buffer RLT with 2% β-mercaptoethanol and a stainless steel bead (5 mm, Qiagen) using a TissueLyser II system (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by RNA extraction with TRIzol using Tissue Lyser II (30 Hz frequency for 2 min with 2 cycles, Qiagen, Germany). Equal amounts of RNA from each sample were reverse transcribed in 20 μl to produce cDNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using the QIAseq SARS-CoV-2 Primer Panel V2 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using QIAseq SARS-CoV-2 Primer Panel V1 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Germany) using a metal ball for 2×2 min at 25 s−1 in 600 μl of RLT buffer (Qiagen, Germany) with 1% β-mercaptoethanol ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 x 2 minute intervals at 25 Hz with the addition of one 7 mm stainless steel bead (Qiagen #69990). 200 uL of tissue lysate was used for KingFisher Flex (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from d2 (n. 2 biological replicates) and d4 (n. 2 biological replicates) cells with QIAzol lysis reagent (Qiagen #79306), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: The RNA extraction kit (RNeasy Mini Kit, Qiagen) was used for the total RNA isolation ...