Labshake search
Citations for Qiagen :
1 - 50 of 3140 citations for Carbamic acid 2 4 hexadienyl 1 1 dimethylethyl ester E E 9ci since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... or pQE30 vectors (expressed in M15 E. coli cells (Qiagen)) ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 µg C19orf43 (purified from E. coli BL21 through Qiagen Ni-TA agarose using standard procedures ...
-
bioRxiv - Biochemistry 2024Quote: ... All multigene-carrying pMB.BIG1a-e plasmids were miniprep (Qiagen #27106) with an extra PE buffer wash and eluted in 40 µL 60 °C Milli-Q water twice ...
-
bioRxiv - Genetics 2022Quote: ... primary erythroblasts or BFU-E using the RNeasy micro kit (QIAGEN). Reverse transcription of mRNA was performed using the SuperScriptIII First-Strand Synthesis System for RT-PCR (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: The cells were lysed by high speed vortexing for 2 minutes using lysing matrix E tubes (MP Biomedical) in buffer RLT (Qiagen) amended with 1% 2-mercaptoethanol ...
-
bioRxiv - Microbiology 2023Quote: ... preceded by a 10-minute bead-beating step at 30 Hz in 2 ml e-matrix tubes (MP Biomedical, USA) using a Tissuelyser II (Qiagen). Molarity and fragment-length distribution of the extracts were measured using a Tapestation ...
-
bioRxiv - Microbiology 2022Quote: ... 1mg of bacterial genomic DNA (isolated from E. coli cells using genomic DNA kit, Qiagen), or tRNA (from E ...
-
bioRxiv - Microbiology 2022Quote: Fecal samples positive for the partial E gene of sarbecovirus were homogenized in TissueLyser II (Qiagen) using 0.1 mm glass beads (Tomy Seiko ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR products were confirmed on E-gels and purified using the QIAquick 96 PCR Purification Kit (Qiagen, 28181). 1-5 uL of the eluted PCR products were submitted for Sanger sequencing to have an initial evaluation of editing before the rest of PCR products were submitted for Amplicon deep sequencing.
-
bioRxiv - Genomics 2020Quote: ... purified nucleic acids were treated with 1-5 μl 1 mg/ml RNaseA (Qiagen) for 45 minutes at 37 °C to degrade RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Approximately 60 homozygous males from each E-box deleted fly line were disrupted in lysis-buffer (Buffer AL, Qiagen) using a motorized microtube homogenizer ...
-
bioRxiv - Biochemistry 2020Quote: ... at 4°C and the supernatant was loaded onto a 1 ml nickel nitrilotriacetic acid-agarose column (Ni-NTA, Qiagen, Hilden, Germany) previously equilibrated with the corresponding lysis buffer ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl RNA was used in a one-step real-time RT-PCR E assay12 using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer ...
-
bioRxiv - Cancer Biology 2020Quote: ... and single erythroid haematopoietic colonies (burst forming unit-erythroid, BFU-E) were plucked and lysed in 50ul of RLT lysis buffer (Qiagen). Library preparation for whole genome sequencing used enzymatic fragmentation and the NEBNext Ultra II low input kit (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl RNA was used in a one-step real-time RT-PCR E assay33 using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: The GST fusion proteins were expressed in bacteria (E. coli, BL21) and purified by glutathione-Sepharose (Cat No. 27-4574-01, Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Samples initially underwent a mechanical lysis step by adding samples to a Lysing Matrix E tube and placed within a Tissuelyzer II (QIAGEN), which were lysed for 1 minute at 30 Hz ...
-
bioRxiv - Immunology 2021Quote: ... 5 μl RNA was used in a one-step real-time RT–PCR E assay using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer ...
-
bioRxiv - Synthetic Biology 2023Quote: Bacterial clones on selection plates were scraped and pooled to extract recombinant plasmids containing the recipient barcodes and DNA blocks (donor barcodes, oligonucleotides, and E. coli ORFs) using Plasmid Plus Mini Kit (QIAGEN). The pooling capacity is determined by the number of unique positioning barcodes ...
-
bioRxiv - Microbiology 2024Quote: ... Verified plasmids were extracted from Escherichia coli (E. coli) using the QIAprep Spin Miniprep Kit or HiSpeed Plasmid Midi Kit (Qiagen) and dialyzed (0.025µM MCE Membrane ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA) ...
-
bioRxiv - Immunology 2023Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen): cDNA ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl Proteinase K (Qiagen, RP107B-1) and 5 µl water was added to each tube with 5 µl sub-library for a final volume of 20 µl per reaction ...
-
bioRxiv - Microbiology 2024Quote: TaqMan RT-qPCR targeting the envelope protein gene (E gene) was performed using the Quantitect Probe RT-PCR kit (Qiagen, Courtaboeuf, France). The model of primers/probe used was as follows ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 1 μM Locked Nucleic Acid (LNA) oligo-d(T)30 (Qiagen) in primary-probe hybridization buffer composed of 40% formamide (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... Samples were diluted at 4:1 (elution buffer (Qiagen)/cDNA ...
-
bioRxiv - Genetics 2021Quote: ... 128° 11’ 17.2” E) and the genomic DNA was extracted from the whole bodies using DNeasy® Blood & Tissue kit (Qiagen, GmbH, Hilden, Germany). Illumina libraries for whole bodies were constructed using the TruSeq Nano Sample Prep kit (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from OSU-CLL cells (1.5e6 cells/mL) treated with DMSO or SpiD3 (1, 2 μM; 4 h) using the miRNeasy Mini Kit (Qiagen; Hilden, Germany) per manufacturer instructions and processed using the Universal Plus mRNA-Seq with NuQuant kit (Tecan ...
-
bioRxiv - Genomics 2020Quote: ... cells were mixed 1:2 with RNAProtect (Qiagen) and harvested via centrifugation ...
-
bioRxiv - Neuroscience 2024Quote: ... for GST-tagged CMK-1 variants or nickel-nitrilotriacetic acid beads (Ni-NTA, Qiagen) in the presence of 15 mM imidazole for TAX-6-His6 protein binding ...
-
bioRxiv - Cell Biology 2022Quote: ... with 1% 2-mercaptoethanol then passed through Qiashredder tubes (Qiagen). RNA was extracted using the RNeasy Isolation Kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... loaded with 1-2 ml Ni-NTA agarose resin (Qiagen) pre-equilibrated with binding buffer ...
-
bioRxiv - Cancer Biology 2021Quote: Liver tissue was homogenized in chloroform/methanol (2:1, 1 mL) using TissueLyser (Qiagen Ltd., Manchester, UK). Deionized water (400 uL ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 1 × 109 CFU of bacteria were mixed at a 2:1 (vol:vol) ratio of RNAProtect (Qiagen) and incubated at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated at 4 °C overnight with Ni2+-nitrilotriacetic acid resin (Qiagen) pre-equilibrated with buffer B ...
-
bioRxiv - Immunology 2022Quote: ... After diluting samples in a 4:1 ratio (elution buffer [Qiagen]:cDNA), cDNA concentration was determined using a Bioanalyzer (Agilent Technologies).
-
bioRxiv - Molecular Biology 2022Quote: ... HL-1 cells were transduced with a pool of 4 gapmers (Qiagen) at 40nM (10Nm each ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM PMSF and the resulting supernatant was incubated with nickel-nitrilotriacetic acid agarose (QIAGEN) overnight at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... The lysates were then incubated for 1 h with nickel-nitriloacetic acid (Ni-NTA) beads (Qiagen) at the indicated temperatures (4°C or room temperature) ...
-
bioRxiv - Genomics 2023Quote: ... cfDNA was isolated from 1 mL of plasma using the QIAGEN Circulating Nucleic Acids Kit (QIAGEN), eluted in AE buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 min, 4°C) prior to incubation (1 h, 4°C) with 4.0 mL of Ni-NTA agarose (Qiagen) pre-equilibrated in the same buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mL of stabilization mix (RNAprotect Bacteria Reagent - Qiagen diluted with PBS in a 2:1 volume ratio) was applied on plates ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...