Labshake search
Citations for Qiagen :
1 - 50 of 834 citations for CTLA 4 Human HEK293 GST since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Equilibrated GST resin (Qiagen) was introduced to cleared lysate and incubated for 2 hours to bind with GST-bound Ash1 fragments ...
-
bioRxiv - Cell Biology 2021Quote: Total mRNA was isolated from HEK293 (2×106) and Jurkat cells (4×106) parental and MCU-KO cell lines using the RNeasy Mini Kit (Qiagen). Isolated RNA was then analyzed using a NanoDrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... for GST purification or Ni-NTA Agarose resin (QIAGEN) for Ni-NTA purification ...
-
bioRxiv - Cancer Biology 2023Quote: ... for GST-tagged protein or Ni-NTA Agarose beads (QIAGEN) for His-tagged protein ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... for GST-tagged protein or on Nickel beads column (Qiagen) for 6XHIS-tagged protein ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells and MEFs were transiently transfected with PolyFect (Qiagen) and Lipofectamine 3000 (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... Targeted knockdown was conducted with 100nM ON-TARGETplus smartpool human c-MYC (mixture of 4 individual siRNA) and/or human KLF6-SV1 siRNA (Dharmacon, Lafayette, CO) with HiPerfect (Qiagen, Valencia, CA).
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transfection of HEK293 cells was performed using Attractene transfection reagent (Qiagen) by the fast-forward transfection approach following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... or EGFP-Lin52 fusions into HEK293-GP cells with Effectene (Qiagen) for transduction as described previously (58).
-
bioRxiv - Biochemistry 2023Quote: ... for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins (2 hr ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK293 or U20S cells with the RNeasy Mini-kit (Qiagen, Hilden, Germany) and quantified with a NanoDrop 8000 spectrophotometer (Thermo-Fisher) ...
-
bioRxiv - Plant Biology 2020Quote: ... and the GST fusion proteins were purified by Glutathione HiCap Matrix columns (Qiagen) and eluted using 50 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2021Quote: Messenger RNA was extracted from HEK293 cells using an RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions and used as the template to synthesise complementary DNA (cDNA ...
-
bioRxiv - Biophysics 2024Quote: The HEK293 stable cell lines were generate by a transfection with Effectene (Qiagen) and 1µg plasmid (pmCherry-N1-hERG-WT and -A561V ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant GST-Dnmt5(1-150)-6xHis was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 66,030 cm-1 M-1) ...
-
bioRxiv - Immunology 2020Quote: Total RNA of IFN-α2 treated HEK293 cells was purified using RNeasy columns (Qiagen) with on-column DNase I digestion ...
-
bioRxiv - Cell Biology 2019Quote: ... knockdown of KCNB1 expression in human cells was carried out using a mixture of 4 siRNA duplexes (Qiagen; Cat# ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Molecular Biology 2019Quote: ... His6- and GST-tagged proteins were affinity-purified in batch on Ni-NTA agarose (Qiagen) and glutathione Sepharose 4 Fast Flow (GE Healthcare) ...
-
bioRxiv - Neuroscience 2020Quote: ... HEK293 cells were transfected with hTRPM3α2-GFP or its mutants using the Effectene reagent (Qiagen). Cells were loaded with 1 μM fura-2 AM (Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... and was run on miScript miRNA PCR Array Human Ovarian Cancer plates (Qiagen, MIHS-110ZE-4, 384 well plate). PCR plates were read the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Cell Biology 2019Quote: ... The mixture was washed 20x with 20 ml GST washing buffer on a disposable column (QIAGEN) The GST-fused protein was eluted with 1 ml GST elution buffer and the eluted sample was dialyzed overnight at 4°C in 2 l 1x PBS in a Slide-A-Lyzer Dialysis Cassette G2 10 000 MWCO (Thermo Scientific).
-
bioRxiv - Microbiology 2021Quote: Total RNA of 1-2 x 106 human macrophages (2-4 biological replicates/ macrophage donors per condition, see Table S17) was isolated using RNeasy extraction kit (Qiagen) including DNAse treatment according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Cell Biology 2019Quote: ... by retrotranscription of RNAs from HeLa and HEK293-T cells using the QuantiTect Reverse Transcription kit (Qiagen) followed by PCR-mediated amplification and plasmid insertion with the in-Fusion cloning kit (Clontech) ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA was extracted from the parental and knockout HEK293 cells using QIAamp DNA mini kit (QIAGEN) and PCR amplified with primers located ~500-600 bp from the sgRNA target site ...
-
bioRxiv - Genetics 2023Quote: The extraction of total RNA from HEK293 stable cell lines was isolated by RNeasy mini kit (QIAGEN), and cDNA was reversed with Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA from magnetically purified human NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 4) hiPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleaved CK1δ ΔC was further purified away from His-GST and His-TEV using Ni-NTA resin (Qiagen) and subsequent size exclusion chromatography on a HiLoad 16/600 Superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... Free GST and thrombin were removed with a second glutathione column and a Ni-NTA column (Qiagen 30210) to remove thrombin ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated from HEK293 cells using the QIAshredder and RNeasy Mini kit (Qiagen, 79654 and 74104, respectively). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: HEK293 cells were seeded in 15 cm plates and transfected after 24h according to manufacturer protocols (Effectene, Qiagen) using 5 µg of plasmid DNA ...
-
bioRxiv - Plant Biology 2023Quote: ... The His and GST tag were cleaved by the Tev protease and separated from AtPAXXL228E using Ni-NTA (Qiagen). AtPAXXL228E was loaded onto a HiTrap Q HP column equilibrated with 20 mM Tris pH7.4 ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA from mouse tissues and cultured HEK293 cells were extracted using DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD). Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Biophysics 2022Quote: ... Supernatants were incubated with glutathione Sepharose (GSH) fast flow beads (GE-Healthcare) for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins for 2 h at 4°C ...
-
bioRxiv - Physiology 2021Quote: RNA was isolated from the three HEK293 cell lines after 48 h in culture using the RNeasy Protect Mini Kit (catalog #74124, Qiagen). After reverse transcription (Super-Script II reverse transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were transfected with plasmids (WT mGlu1, the mGlu1 mutants, or the control vector) using SuperFect transfection reagent (Qiagen) or Viafect (promega ...
-
bioRxiv - Microbiology 2019Quote: ... Approximately 5×106 HEK293 cells were used to isolate RNA with the All Prep RNA/DNA Mini Kit (Qiagen; 80204). cDNA was generated using 1μg of RNA with oligo(dT ...
-
bioRxiv - Cell Biology 2024Quote: ... into 4 million HEK293-GP cells in 300 µl Buffer EC with 16 µl Enhancer and 60 µl Effectene Transfection Reagent (Qiagen 301425) (Morgenstern and Land ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...