Labshake search
Citations for Qiagen :
1 - 50 of 1589 citations for Borrelia burgdorferi sensu stricto B31 CRASP 2 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... burgdorferi B31-e2 expression strains using the DNeasy Blood and Tissue Kit (Qiagen). The open reading frame (lacking the putative lipoprotein signal sequence ...
-
bioRxiv - Microbiology 2022Quote: ... burgdorferi cultures (around 108 cells) using the RNeasy Mini kit (Qiagen). DNA contamination in the RNA samples was removed by DNase I (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... burgdorferi-infected zebrafish following manufacturer’s instructions for the RNeasy mini kit (QIAGEN, #74104).
-
bioRxiv - Microbiology 2020Quote: ... burgdorferi strain and DNA was extracted using a DNeasy Blood and Tissue kit (Qiagen, Germantown, MD). DNA from ear tissue was subjected to qPCR analysis to verify infection in each host (30) ...
-
bioRxiv - Molecular Biology 2019Quote: ... recombinant protein was enriched via a Ni+2-nitroloacetic acid column (Ni-NTA; Qiagen), as described previously (Edwalds-Gilbert et al ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM 2-mercaptoethanol) and the proteins eluted from nickel-NTA agarose beads (Qiagen; using buffer containing 25 mM Tris-HCl (pH 7.6) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein purification was performed using Ni+2-NTA agarose affinity chromatography according to standard protocol (Qiagen).
-
bioRxiv - Biochemistry 2022Quote: ... Protein extract was subjected to IMAC by incubation with 2 ml Ni-NTA resin (Qiagen, Germany) per 50 ml of extract ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 RBD-His protein was purified from cell culture supernatant using a Ni-NTA (Qiagen) affinity column ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins with log fold change >1 and Z-score > 2 were further analyzed in Ingenuity Pathway Analysis (IPA, Qiagen) to determine pathways enriched by the bait proteins ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins with log fold change >1 and Z-score > 2 were further analyzed in Ingenuity Pathway Analysis (IPA, Qiagen) to determine pathways enriched by the bait proteins ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant containing target proteins was passed through a polypropylene column containing 2 ml Ni-NTA resin from Qiagen. After the target protein bound to the Ni-NTA resin ...
-
bioRxiv - Immunology 2020Quote: SARS-CoV-2 ELISA was developed in-house using His tagged proteins bound on Ni-NTA HisSorb Strips or Plates (Qiagen). ELISA assay on mouse sera were performed with His-tagged SARS-CoV-2 full length Spike protein (produced in baculovirus ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA and proteins were extracted from fresh or snap-frozen FACS-sorted 2-5 million splenic B cells using AllPrep DNA/RNA/Protein Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and ∼55 mg of total protein in CFE was incubated for 60 min at 4 °C with 2 mL of Ni-NTA agarose (QIAGEN, Germany) equilibrated with purification buffer A ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Halo protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9 wash buffer I (50 mM NaxPO4 pH 7.0 and 300 mM NaCl ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Cys protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9-Cys wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Genetics 2021Quote: ... followed by protein precipitation with the Protein Precipitation Solution (Qiagen) for 10 min at -20 °C ...
-
bioRxiv - Bioengineering 2021Quote: ... Protein extraction was conducted using a Qproteome Bacterial Protein Prep Kit (Qiagen)‡ ...
-
bioRxiv - Cancer Biology 2022Quote: ... and protein isolation with the AllPrep DNA/RNA/Protein Mini Kit (Qiagen).
-
bioRxiv - Cancer Biology 2023Quote: ... Protein-protein interaction networks were built using Ingenuity Pathway Analysis (IPA) (Qiagen).
-
bioRxiv - Genetics 2021Quote: ... Protein Precipitation Solution (Qiagen) was added at 0.33x and mixed well ...
-
bioRxiv - Cancer Biology 2022Quote: Whole tissue protein was extracted by Qproteome Mammalian Protein Prep Kit (Qiagen, 37901) according to the manufacture’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... and protein were extracted using the AllPrep DNA/RNA/Protein kit (Qiagen, #47054). Sample concentrations were measured with Qubit high sensitivity dsDNA and RNA platform ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were precipitated by adding 100 μL of a protein precipitation solution (Qiagen). Samples were centrifuged for 5 min at 13000 rpm ...
-
bioRxiv - Genomics 2020Quote: ... Protein was precipitated by adding 200 µL of ice-cold Protein Precipitation Solution (Qiagen), gentle mixing and incubation on ice for 10 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The peptide-coupled proteins were separated from uncoupled proteins using Ni-NTA Agarose (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... N-terminal His-tagged proteins were purified using a QIAexpress protein purification system (Qiagen), as previously described47.
-
bioRxiv - Neuroscience 2020Quote: ... Total protein was extracted using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen #80004) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... and Fc-tag ACE2 protein was purified using a protein affinity A column (Qiagen). Proteins were further purified by gel filtration (Superdex™ 200 Increase 10/30GL ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total protein was purified by the AllPrep DNA/RNA/Protein Mini Kit (Qiagen: # 80004). Corresponding protein expression levels in the cells of different groups were detected by western blot using the following antibodies ...
-
bioRxiv - Cell Biology 2023Quote: Cells were harvested for total protein using a Qproteome Mammalian Protein Prep Kit (Qiagen). Total protein was quantified using a PierceTM BCA Protein Assay Kit (Cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... 333µl Protein Precipitation Solution (Qiagen) was added and samples were vortexed vigorously for 20 seconds at high speed ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein Precipitation Solution (Qiagen #158910), DNA Hydration Solution (Qiagen #158914 ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2021Quote: ... Protein was extracted 48 hours post transfection with All Prep RNA/Protein Kit (Qiagen, USA). Protein concentrations were determined by Lowry assay (Bio-Rad ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: ... protein extraction was performed using the Allprep RNA/Protein Kit (80404 Qiagen Inc., Hilden, Germany). Proteins (10–20 µg ...
-
bioRxiv - Cancer Biology 2022Quote: ... and protein extraction were performed according to manufacturer instructions (AllPrep DNA/RNA/Protein minikit; Qiagen). Each spin column flowthrough (DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was isolated from powdered tissues using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen). Protein pellets were lysed in HES-SDS buffer (20 mM HEPES [pH 7.4] ...
-
bioRxiv - Cell Biology 2023Quote: Cells were collected for total protein using Qproteome Mammalian Protein Prep Kit (Cat. 37901, Qiagen). Lysates were quantified for protein expression utilizing the WES system (ProteinSimple ...
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged proteins were purified using the QIAexpress Ni-NTA Protein Purification System (Qiagen) with 0.1 M ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... The expressed protein was purified as His-tagged fusion protein using Ni-NTA agarose beads (Qiagen) and analyzed by SDS-PAGE.
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified using the His-tag Protein Purification Kit (Ni-NTA Agarose, QIAGEN GmbH), GST-tag Protein Purification Kit (Glutathione Sepharose ...
-
bioRxiv - Molecular Biology 2023Quote: Total proteins from P5 hippocampi were purified with AllPrep DNA/RNA/Protein Mini Kit (Qiagen, 80004). The protein pellets were then resuspended in 90 μl Buffer ALO (Qiagen ...
-
bioRxiv - Physiology 2020Quote: ... protein was extracted (Qiagen Tissue Lyser) from ∼50 mg frozen liver in tissue lysis buffer 80 ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL Protein Precipitation Solution (QIAGEN) was added ...
-
bioRxiv - Cancer Biology 2023Quote: Advanced Protein Purification buffer (APP; Qiagen): the APP buffer contains zinc chloride to precipitate protein at room temperature ...