Labshake search
Citations for Qiagen :
1 - 50 of 1383 citations for Borrelia burgdorferi C t Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... burgdorferi cultures (around 108 cells) using the RNeasy Mini kit (Qiagen). DNA contamination in the RNA samples was removed by DNase I (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... burgdorferi B31-e2 expression strains using the DNeasy Blood and Tissue Kit (Qiagen). The open reading frame (lacking the putative lipoprotein signal sequence ...
-
bioRxiv - Microbiology 2022Quote: ... burgdorferi-infected zebrafish following manufacturer’s instructions for the RNeasy mini kit (QIAGEN, #74104).
-
bioRxiv - Microbiology 2020Quote: ... burgdorferi strain and DNA was extracted using a DNeasy Blood and Tissue kit (Qiagen, Germantown, MD). DNA from ear tissue was subjected to qPCR analysis to verify infection in each host (30) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Physiology 2019Quote: ... Methylation status of the individual CpG sites was identified as an artificial C/T SNP using QCpG software (Pyrosequencing, Qiagen, UK). Then % methylation of each CpG site was then calculated as a proportion of the methylated alleles divided by the sum of all methylated and unmethylated alleles ...
-
bioRxiv - Cell Biology 2023Quote: ... significantly regulated human proteins (t-test, p-value ≤ 0.01; described above) were characterized by core analysis in IPA® software (version 68752261, QIAGEN Inc. ...
-
bioRxiv - Cancer Biology 2019Quote: ... Protein digestion was performed on the eluted DNA samples at 50°C for 30 minutes (Qiagen Protease mix). ChIP DNA was purified using Sera-Mag beads (Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated from cultured in vitro or in vivo primed T cells or ex vivo sorted T cells using the RNeasy kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant both N-and C-terminally His-tagged proteins were purified using a Ni-NTA Superflow cartridge (1ml, Qiagen) and the Fast Protein Liquid Chromatography (FPLC ...
-
bioRxiv - Microbiology 2024Quote: ... Flag-SHOC2 was cleaved from 6X-His-MBP by incubating 37 mg purified protein with 0.65 mg TEV protease at 4°C overnight followed by affinity purification using Nickel affinity resin (Qiagen) where cleaved Flag-SHOC2 was collected in the flow-through.
-
bioRxiv - Biochemistry 2020Quote: Initial crystals of Nup133NTD-VHH-SAN5 were obtained at 18°C in 1 day as part of the Protein Complex suite (Qiagen) in a 96-well sitting drop tray with a reservoir containing 15% PEG MME 2,000 ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell debris were removed by centrifugation (35,000 g at 4°C for 20 min) and the N-terminal His-tagged proteins were purified from the supernatant using NiNTA agarose (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... C-terminal His-tagged proteins were purified by gravity-flow chromatography on a nickel nitrilotriacetate (Ni-NTA) agarose resin (Qiagen) according to the manufacturer’s recommendations followed by an exclusion chromatography on a Superdex75 column connected to an ÄKTA Purifier™ (GE Healthcare) ...
-
bioRxiv - Biophysics 2020Quote: ... 45 min at 4 °C) and supernatant containing His-tagged proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) purification (Qiagen). Protein was eluted in a final elution buffer of 20 mM Tris pH 8.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tumour samples were fresh-frozen in liquid nitrogen and stored at -80°C for protein isolation or preserved in RNAlater solution (Qiagen) for RNA isolation ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pathways significantly affected in non-T cell-inflamed or non-T cell-inflamed-enriched mutated genes were identified by IPA® (QIAGEN Inc., Germany).
-
bioRxiv - Synthetic Biology 2020Quote: ... and ∼55 mg of total protein in CFE was incubated for 60 min at 4 °C with 2 mL of Ni-NTA agarose (QIAGEN, Germany) equilibrated with purification buffer A ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Halo protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9 wash buffer I (50 mM NaxPO4 pH 7.0 and 300 mM NaCl ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Cys protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9-Cys wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cancer Biology 2019Quote: ... T cells were sorted directly into 250μl RNAprotect buffer (Qiagen), spun down for 1 minute at 2000 RPM ...
-
bioRxiv - Immunology 2021Quote: Purified CD4+ T cells were homogenized using the Qiashredder (Qiagen, 79654) and RNA was extracted using the RNeasy Plus Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... 4A-C and 5A-C were lysed in buffer RLT (Qiagen). The cell solution/suspension? was homogenised using QIAshredder columns (Qiagen ...
-
bioRxiv - Developmental Biology 2024Quote: ... using a touchdown PCR for the first 10 cycles from 72 to 60 followed by 35-40 cycles at the proper annealing temperature (Tm −2°C) and extension 68°C 30sec/Kb or 72°C 15sec/Kb and purified using a PCR purification KIT (Qiagen). Equimolar amounts of PCR products were mixed and a PCR was made with a primeSTAR GXL DNA polymerase (Takara Bio ...
-
bioRxiv - Genetics 2019Quote: ... 59°C for 180 s and 72°C for 30 s (Qiagen Multiplex kit handbook ...
-
bioRxiv - Immunology 2020Quote: ... Sorted T cells were lysed in Buffer RLT Plus (Qiagen, Hilden, Germany) with 1% β-mercaptoethanol (Millipore-Sigma ...
-
bioRxiv - Physiology 2020Quote: ... and Student’s t tests for significance per the manufacturer’s analytical software (Qiagen), with results plotted as fold change showing 95% confidence limits ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 1 μM Locked Nucleic Acid (LNA) oligo-d(T)30 (Qiagen) in primary-probe hybridization buffer composed of 40% formamide (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... or CD4+ T cells was extracted using the RNeasy micro kit (Qiagen) followed by cDNA synthesis using the iScript cDNA synthesis kit (BioRad) ...
-
bioRxiv - Immunology 2021Quote: ... and an undisclosed peptide pool inducing CD8+ T lymphocyte stimulation (Qiagen, 2017); rmsHBHA which tubes contain recombinant M ...
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated from T cells using the RNeasy kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: Total RNA was extracted from isolated CD8+ T cells (RNeasy kit, Qiagen) and 300 ng of RNA were used for cDNA synthesis (First-Strand Synthesis kit ...
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated from murine T cells via RNeasy Kit (Qiagen) with DNase digestion (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... and CD95+ CD4 T cells using a RNeasy plus mini kit (QIAgen). Isolated RNA sample quality was assessed using a BioAnalyzer RNA pico assay (Agilent Technologies Inc. ...
-
bioRxiv - Genetics 2021Quote: ... and end-point PCRs were performed following 34 cycles (94 C 30 sec, 58 C 30 sec, 72 C 1 min) using the HotStarTaq Plus DNA polymerase (Qiagen, Canada) according to manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... RNA and protein were digested in 40 mM Tris-HCl pH 6 and 10 mM EDTA by adding first RNAse A (Qiagen; #19101, 1.5 hours, 37°C), followed by Proteinase K (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... total mRNA was isolated from mouse T cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Immunology 2024Quote: ... total RNA was extracted from T cells by using RNeasy mini kit (QIAGEN) and reverse-transcribed into cDNA with Superiorscript III reverse transcriptase (Enzynomics ...
-
bioRxiv - Immunology 2024Quote: T cells were subjected to RNA extraction utilizing the RNeasy Micro Kit (QIAGEN). RNA from the renal cortex was isolated with the NucleoSpin Kit (Macharey-Nagel ...
-
bioRxiv - Genomics 2021Quote: ... and grown at 30°C or 37°C for the plasmid DNA preparation (Qiagen miniprep). The resulting plasmids were sequence-verified using Sanger sequencing (Genewiz).
-
bioRxiv - Genetics 2021Quote: ... followed by protein precipitation with the Protein Precipitation Solution (Qiagen) for 10 min at -20 °C ...
-
bioRxiv - Immunology 2021Quote: ... total RNA of CD8+ human T cells was extracted by miRNeasy Mini Kit (Qiagen), following the manufacturers’ instructions ...
-
bioRxiv - Neuroscience 2022Quote: Cultured human T cells after treatment were flash frozen in Buffer RLT (Qiagen, 79216) and kept in −80°C until processing ...
-
bioRxiv - Genomics 2024Quote: ... genomic DNA from human primary T cells was isolated using Gentra Puregene Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted from sorted CD4+ T cells using the RNeasy Mini kit (Qiagen). A total of 8.5 µL extracted RNA was subjected to one-step RT-PCR using the Superscript III one-step RT-PCR system (Invitrogen) ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from CD4+ T cells using the DNeasy blood and tissue kit (Qiagen), according to manufacturer’s protocol.
-
bioRxiv - Immunology 2019Quote: ... The total RNA of sorted T cells was extracted with an RNeasy Micro kit (Qiagen) and reverse transcribed using reverse transcribed using SuperScript III Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... primary T cells and BJ-5at fibroblasts using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-stand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was extracted from sorted T cell populations with mini RNA-easy Kit (Qiagen). Equal amounts of total RNA from different groups were used for the assay ...
-
bioRxiv - Immunology 2022Quote: ... DNA for library preparation was extracted from CD8+ T-cells using FlexiGene DNA Kit (Qiagen). 150 ng aliquots of obtained DNA were used as input to prepare each out of four TRA libraries ...