Labshake search
Citations for Qiagen :
1 - 50 of 2496 citations for BFF 122 CAS 1152314 49 2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 99% Buffer TCL (Qiagen, cat# 1031576), sealed with perfluorinated oil (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: We produced pseudoviruses as previously described (47–49) using Effectene (Qiagen). Briefly ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: For SYBR Green and Taqman PCR Serial dilutions of known standards were made using synthetic miR-122 (syn has-miR-122-5p, 219600, Qiagen). The dilutions were prepared in triplicate ...
-
bioRxiv - Genomics 2021Quote: ... The mmu-miR-122-5p miRCURY LNA probe (YD00615338, QIAGEN) was used to detect the dre-miR-122-5p mature form ...
-
bioRxiv - Physiology 2023Quote: ... was set within the exponential phase of the PCR using the Rotor-Gene Q Series software (v.2.3.1, Build 49, Qiagen, Hilden, Germany). The PCR product was quantified using the 2−ΔΔCt method ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2 μl of 10 mg/ml RNase (Qiagen Valencia, CA, USA) was added to each of the samples and kept at 4°C for 30 minutes to remove fragments of RNA strands.
-
bioRxiv - Microbiology 2020Quote: ... Lung samples were homogenized with DMEM + 2% FBS in a TissueLyser (Qiagen Inc., CA) operated at 25-30 Hz for four minutes ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was extracted from the red blood cells of the parents and 99 F2 hybrid females using the DNeasy Blood & Tissue Kit (Qiagen). The library was constructed according to a previously described method [27] ...
-
bioRxiv - Microbiology 2023Quote: ... The aqueous phase was removed and transferred to MaxTract High Density 2 mL tubes (Qiagen Inc, Valencia, CA, USA). Samples were then extracted a second time as described above and the aqueous phase from the repeated extractions for each sample were combined ...
-
bioRxiv - Microbiology 2021Quote: ... in Tris/HCl/Ca+2 buffer was subjected to extraction in house using the silica method or QIAamp viral RNA mini kit (Qiagen) according to the manufacturer’s guidelines.
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR was monitored on Rotor-Gene® Q-Pure Detection System (Software Ver. 2, Qiagen Inc., Valencia, CA, USA) and performed using QuantiFast SYBR® Green PCR Master Mix (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK-beta cells were transiently transfected with WT or variant NaV1.2 (2 µg) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.).
-
bioRxiv - Neuroscience 2022Quote: Dissected cortex and striatum were homogenized 2 x 1min at 25 Hz in 750μL of QIAzol Lysis Reagent (Qiagen, Valencia, CA) with TissueLyser (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from a SARS-CoV-2 Omicron BA.1 clinical isolate (SARS-CoV-2/human/USA/CA-CDC-4358237-001/2021) (GenBank: OM264909.1) using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany). The complete wild-type Omicron genome was then reverse transcribed via RT-PCR with SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2022Quote: Total RNA was extracted from the lungs of uninfected and SARS-CoV-2 infected hamsters with or without immune suppression using Trizol reagent and purified by RNeasy mini columns (Qiagen, CA, USA) as described previously 61 ...
-
bioRxiv - Physiology 2019Quote: Total RNA was prepared by lysing cell pellets (2×106) in 700 μl Qiazol and extracted using Qiagen miRNeasy mini kit according to the manufacturer’s recommendation (Qiagen Inc, CA, USA) from the same samples (n=54) ...
-
bioRxiv - Genomics 2019Quote: ... Total RNA was isolated from whole blood (2.5mL) thawed at room temperature for 2 hours prior to using the PAXGene RNA extraction kit (Qiagen, Chatsworth, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... bearing a C-terminal histidine tag (ACRO Biosystems, Newark, NJ) was coated at 2 μg/ml on a Ni-NTA plate (Qiagen, Valencia, CA). After washing and blocking ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Ligated DNA fragments ranging in size from 300 to 450 base pairs (bp) were extracted from 2% low-melt agarose gels and purified using a MinElute gel extraction kit (Qiagen, Valencia, CA). The recovered fragments were amplified using PCR ...
-
bioRxiv - Physiology 2022Quote: ... Genomic DNAs of 61 weaned pups (2 pups died before weaning) were collected from their tails with a DNeasy Tissue kit (Qiagen, Valencia, CA). Six Ptger3-tTA BAC transgenic founder rats were identified by PCR for the presence of the tTAad-BGH insert ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Qiagen (Qiagen, Valencia, CA) and qPCR was performed using the Qiagen miSCRIPT SYBR® Green PCR kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... transferred to the laboratory (within 2 hours) on ice and immediately processed for DNA extraction using the DNeasy PowerSoil kit (Qiagen, Valencia, CA, USA) according to manufacturer protocols ...
-
bioRxiv - Microbiology 2021Quote: ... were selected with a P<0.05 and 2-fold change in gene expression and used for network/pathway analysis using Ingenuity Pathway Analysis (IPA; Qiagen, Valencia, CA, USA) as described previously (5).
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Immunology 2019Quote: ... purified (Qiagen, Valencia, CA) and Expi293 cells were transfected using ExpiFectamine™ (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... respectively (Qiagen, Valencia, CA). Metatranscriptomic libraries were sequenced in two lanes of Illumina’s NovaSeq 6000 System flow cell utilizing the NovaSeq Xp workflow (SE 120bp ...
-
bioRxiv - Neuroscience 2022Quote: ... with TissueLyser (Qiagen, Valencia, CA) and 5mm stainless steel beads (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5S rRNA (Qiagen, CA). All reactions were performed in triplicate ...
-
bioRxiv - Biophysics 2019Quote: ... RNeasy Mini (Qiagen, Valencia, CA) was used to isolate the RNAs ...
-
bioRxiv - Physiology 2023Quote: ... respectively (Qiagen, Valencia, CA, USA). Isolated RNA was reverse-transcribed into cDNA using M-MLV Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Molecular Biology 2021Quote: ... with SYBR Green (QIAGEN, Valencia, CA) as the detection method ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and RNeasy Kit (Qiagen, Valencia, CA) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... following PCR purification (Qiagen, Valencia, CA), and will be cloned into the pLenti6.3/V5-TOPO lentiviral vector (Invitrogen) ...
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... using SYBR green (Qiagen, Valencia, CA). The mouse forward primer sequence (5’-3’ ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR purification kit (Qiagen, Valencia, CA) was used for DNA purification ...
-
bioRxiv - Physiology 2021Quote: ... using SYBR green (Qiagen, Valencia, CA). The mouse primer sequences ...
-
bioRxiv - Pathology 2022Quote: ... The N gene-specific primers were used to amplify 97 bp of SARS-CoV-2 N gene by conventional PCR and purified by Qiagen gel extraction kit (Qiagen, CA, USA). The purified N gene PCR products were used in real-time PCR to prepare a standard curve and determine the viral copy numbers in the lung samples.
-
bioRxiv - Immunology 2023Quote: ... AllPrep column purification (Qiagen, Valencia, CA) was used to isolate RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA-free DNase (Qiagen, CA, USA) was added to the column to digest any DNA present in the sample ...
-
bioRxiv - Microbiology 2023Quote: ... from SABiosciences (Qiagen, Valencia, CA, USA) for the chemokine IL-8 according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... stainless steel beads (Qiagen, CA, USA). Chloroform was then used for phase separation ...
-
bioRxiv - Physiology 2023Quote: ... with Trizol reagent (Qiagen, Carlsbad, CA) added to the resulting bone powder ...
-
bioRxiv - Physiology 2024Quote: ... using SYBR green (Qiagen, Valencia, CA). The mouse primer sequences ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... HiPerFect reagent was from Qiagen (Valencia CA).
-
bioRxiv - Molecular Biology 2021Quote: ... The Effectene transfection reagent (Qiagen, Valencia, CA) was used following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2019Quote: ... by QIAGEN DNA Mini Stool Kit (QIAGEN, Valencia, CA) according to manufacturer’s recommendations ...