Labshake search
Citations for Qiagen :
351 - 400 of 959 citations for BD 3 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... RNA samples from 3 independent cultures for each strain (Chr_dam and Chr_gfp) were extracted with RNeasy miniprep kit (Qiagen). Primers used are listed in Table S1 ...
-
bioRxiv - Genetics 2020Quote: ... 4 dpe on-tet n=3) was extracted using the Qiagen RNeasy Mini Plus Kit (Qiagen, Hilden, Germany), which includes a column-based genomic DNA removal step ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from an aliquot of 3 x 106 cells using the RNeasy Plus Kit (Qiagen). cDNA was synthesized from extracted RNA using the iScript cDNA Synthesis Kit (BioRad ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Molecular Biology 2022Quote: ... genomic DNA was isolated from HEK293T cells 3 days after transfections using the Gentra Puregene Cell Kit (Qiagen) and was diluted to 10 ng/μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed 3 times with PBS and had their genomic DNA extracted with the QIAamp DNA mini kit (QIAGEN). Sequencing libraries were prepared at GenomeScan (Netherlands ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from 0 or 3% CSE-treated bronchospheres using the Qiagen RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Microbiology 2023Quote: ... Individual mosquitoes were homogenized for 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). DNA extraction of individual larvae was carried out using the QIAamp DNA Kit (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA was extracted from 3-week-old plants using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Biochemistry 2023Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from 3 dpf zebrafish AB larvae (50 fish) using RNAeasy Plus Kit (Qiagen 74134). cDNA was synthesized using SuperScript IV Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed in an Applied Biosystems QuantStudio 3 using the QuantiTect® Multiplex PCR Kit (QIAGEN). The primers and probes used are listed in Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: siRNA targeting human GPRC5A (siGPRC5A_4 against target sequence 5′-CTGGGTGTGTTGGGCATCTTT-3′, cat# SI04438021) and non-targeting control siRNA (cat# Ctrl_AllStars_1, target sequence not disclosed) were purchased from Qiagen. Human primary keratinocytes were transfected at 20 nM final siRNA concentration using Lipofectamin 2000 reagent (Life Technologies ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA was then isolated for each biological replicate (3) using an RNeasy Lipid Tissue Mini kit (Qiagen). DNA contamination was removed using TURBO DNA-free (Ambion) ...
-
bioRxiv - Genomics 2024Quote: ... with two 3 mm metal beads and ground into a fine powder with a TissueLyser II (Qiagen, Germany) at 30 Hz for 2 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... miRCURY LNA Power Inhibitor against mouse miR-375 (mmu-miR-375-3p) (Qiagen, Hilden ...
-
bioRxiv - Genetics 2021Quote: ... Total RNA was extracted from mouse liver samples using RNeasy Mini Kit (Qiagen), DNase treated and 1 μg total RNA was processed for mRNA sequencing ...
-
bioRxiv - Neuroscience 2020Quote: Pre-weighed cortex pieces from mouse brains were homogenized in QIAzol (Qiagen 79306), at 1ml volume per 100mg of tissue ...
-
bioRxiv - Physiology 2020Quote: Total RNA was isolated from mouse tissues using QIAzol Lysis Reagent Protocol (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA of mouse islets was extracted using RNeasy Plus Mini Kit (Qiagen). Other tissues including mouse liver ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from mouse right adrenals using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from mouse right adrenals using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... the RNA from mouse liver was isolated using RNeasy Mini Kit (Qiagen, 74104) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... Anti-tetra-His-tag mouse monoclonal antibody (mAb) IgG1 was purchased from Qiagen Com ...
-
bioRxiv - Genomics 2019Quote: We analyzed human and mouse Tug1 cDNA sequences with CLC Genomics Workbench (Qiagen) for open reading frames (ORFs) ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... we prepared total RNA from dissected wildtype mouse brain regions using Qiazol (Qiagen) and prepared cDNA using the SuperScript III first-strand synthesis kit (Invitrogen) ...
-
bioRxiv - Genetics 2019Quote: Total RNA was extracted from mouse pituitaries using an RNeasy mini kit (Qiagen) and 250 ng converted to cDNA using Revertra Ace (TOYOBO ...
-
bioRxiv - Genetics 2020Quote: Mouse tissues were disrupted and homogenized using QIAzol lysis reagent (Qiagen, Hilden, Germany) and the Tissue Lyser instrument (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... or RNeasy Mini Kit (synaptosome and cytosolic fraction from homogenized mouse forebrain; Qiagen). For RT-PCR ...
-
bioRxiv - Immunology 2020Quote: RNA from mouse plasma was isolated using Qiamp RNA-mini isolation kit (Qiagen) and RNA from tissues isolated using the RNeasy mini isolation kit (Qiagen) ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was isolated from mouse B cells using the DNeasy kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Proteins were extracted from frozen mouse left ventricles using the TissueLyser LT (Qiagen) with 5mm stainless steel beads (69989 ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted from mouse neural retina using RNeasy mini kit (QIAGEN). Total RNA was reverse transcribed in the presence of PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time ...
-
bioRxiv - Physiology 2023Quote: ... total RNA was prepared from mouse liver using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2023Quote: We extracted RNA from fresh mouse using an AllPrep DNA/RNA kit (Qiagen). We placed 5-10 mg of tissue into 350 μL RLT Plus Buffer in a 2 mL tube containing a 5mm stainless steel bead and homogenized with a TissueLyzer for two 2 min rounds at 30 Hz ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse monoclonal antibody that recognizes the strep-tag epitope was purchased from Qiagen. Recombinant NifB expressed in E ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from mouse ESCs with QIAzol lysis reagent (Qiagen #79306), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... and the mouse hippocampal tissues (n=5-6/group; Qiagen, Germantown, MD, USA). The samples of the RNA (500ng/µL ...
-
bioRxiv - Immunology 2023Quote: ... Total mRNA was extracted from mouse tumors using the RNeasy Mini Kit (QIAGEN) and subsequently tested for concentration and integrity via NanoDrop 2000c (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... total mRNA was isolated from mouse T cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic DNA from 3×107 sorted GFP+ cells was extracted using the Blood & Cell Culture DNA Maxi Kit (Qiagen). Amplification of sgRNA regions from the extracted genome and the original sgRNA plasmid library ...
-
bioRxiv - Molecular Biology 2020Quote: ... while method-3 was a modified protocol of the DNeasy PowerMax Soil Kit (Cat.No. 12988-10) provided by Qiagen (based on communication exchanged with the manufacturer) ...
-
bioRxiv - Cell Biology 2019Quote: Transduced GFP+ LT-HSCs from 3 independent biological replicates were sorted directly into 350 ul of RLT buffer (Qiagen). Total RNA was isolated from cells using the RNeasy Micro kit (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was purified from cell passage number 3 using the RNeasy RNA purification kit (Qiagen Cat. No. 75142). A260:280 ratio > 2 and RIN > 9.
-
bioRxiv - Immunology 2021Quote: Bacterial plasmid DNA was extracted from a 3 ml overnight culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Next ...