Labshake search
Citations for Qiagen :
1 - 50 of 658 citations for 8 bromo 4 methoxyquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... of healthy (4 weeks of age) and hTNFtg mice (4 & 8 weeks of age) using the RNeasy mini or micro kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was isolated from cSCC cell lines (n = 8) and NHEKs (n = 4) using miRNeasy Mini Kit (Qiagen), and the RNA-seq analysis was performed using Illumina HiSeq2500 system using paired-end sequencing chemistry with 100bp read length (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Microbiology 2019Quote: ... 700 μL of cold methanol and 140 μL of EDTA 0.1M were added and vigorously mixed (4 x 45 s) in a mini-bead-beater-8 (Biospec Products, Qiagen). By this way ...
-
bioRxiv - Neuroscience 2022Quote: At DIV 28-30 iPSC-MG from 8 C9orf72 ALS/FTD patient lines and 4 control lines were pelleted and lysed using QIAshredder (QIAGEN-79654) and RNA was isolated with RNeasy Mini Kit (QIAGEN-74104 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Genomic DNA from 4-8 microdissected 10 μm FFPE sections were extracted using the QIAamp DNA FFPE Tissue kit (Qiagen, cat. no. 56404) according to manufacturer instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... paired-end (37:8:8:38) RNA-sequencing using a RNeasy Micro kit (Qiagen #74004) for RNA extraction ...
-
bioRxiv - Bioengineering 2022Quote: ... We conducted standard bulk paired-end (37:8:8:38) RNA sequencing using RNeasy Micro (Qiagen, 74004) for RNA extraction ...
-
bioRxiv - Systems Biology 2021Quote: We conducted standard bulk paired-end (37:8:8:38) RNA sequencing using RNeasy Micro (Qiagen 74004) for RNA extraction ...
-
bioRxiv - Cancer Biology 2019Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...
-
bioRxiv - Cancer Biology 2020Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...
-
bioRxiv - Microbiology 2020Quote: DNA extractions from the 8-week fecal samples (n = 8 per group) were performed using the Qiagen QIAmp DNA stool extraction kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by adding 8 µl Effectene Enhancer (Qiagen), vortexing and incubation for 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... Soil samples (8 g) preserved in LifeGuard solution (Qiagen) were thawed on ice and centrifuged at 2,500 x g for 5 minutes to collect the soil at the bottom of the tubes ...
-
bioRxiv - Biochemistry 2020Quote: ... 8×105 cells with the RNeasy mini kit (Qiagen) in combination with the QIAshredder system (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: Sequences were imported into CLC Genomics Workbench 8 (QIAgen) and were mapped to the dd_Smed_v6 transcriptome (Brandl et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... CLC Genomics Workbench 8 (Version 8.5.1, Qiagen, Germantown, MD, USA) was used to trim ...
-
bioRxiv - Microbiology 2022Quote: ... thaliana leaves at 8 dpi using an RNeasy kit (QIAGEN). We amplified the candidate sequences for the genes of interest with PCR using Phusion® High-Fidelity DNA polymerase (NEB ...
-
bioRxiv - Systems Biology 2020Quote: ... IL-8 ELISA was performed according to manufacturer instructions (Qiagen).
-
bioRxiv - Molecular Biology 2021Quote: 8 different polymerases (KAPA HiFi HotStart, Qiagen Taq, Q5 (NEB), Phusion Hot Start Flex DNA Polymerase (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... Lysate was passed over 8 ml Ni-NTA resin (Qiagen), washed with 70 ml wash buffer (20 mM HEPES-KOH pH 7.5 ...
-
bioRxiv - Genomics 2023Quote: ... The Puregene Cell Kit (8×108) (Qiagen, Cat. No. 158767) was used for all genomic DNA (gDNA ...
-
bioRxiv - Microbiology 2023Quote: ... supernatant was poured over 8 mL Ni-NTA resin (Qiagen), resin was washed with 35 mL lysis buffer supplemented with 1 M NaCl ...
-
bioRxiv - Microbiology 2019Quote: ... 8 ml of bed volume of Ni-NTA resin (Qiagen, Germany) was added and incubated for one hour with gentle agitation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sequences were manually curated with CLC Main Workbench 8 software (Qiagen) before being aligneed with the Muscle program implemented in the workbench to generate haplotypes by line for each intron ...
-
bioRxiv - Genomics 2021Quote: ... 8 and 10 of differentiation as recommended (RNAeasy Minikit. Qiagen 74106). Mineralized nodule formation was measured by staining cultures with Alizarin Red (40 mM ...
-
bioRxiv - Microbiology 2022Quote: ... and lysate was passed over 8 mL Ni-NTA resin (Qiagen) using gravity chromatography ...
-
bioRxiv - Immunology 2023Quote: ... and disrupted for 8 minutes in 300 μL ATL buffer (Qiagen) using a Qiagen Tissuelyser at 50Hz with a ceramic bead (MPBio) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 8 wells of cell death control (Qiagen AllStars Positive Control siRNA), and 8 wells of YAP targeting siRNA (Ambion Silencer Select ...
-
bioRxiv - Microbiology 2024Quote: ... Supernatant was passed over 8 ml of Ni-NTA resin (Qiagen), and the resin was washed with 70 ml of lysis buffer supplemented to 1 M NaCl followed by 20 ml lysis buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 h post-infection) using the QIAamp DNA micro kit (QIAGEN). As a parallel control ...
-
bioRxiv - Neuroscience 2023Quote: ... gcy-8 mRNA was detected using a OneStep RT-PCR kit (QIAGEN) from 3 ng of template RNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tissues were weighed and homogenized in 4 volumes of water (4 µL of water/mg tissue, 4°C) using a bead beater (TissueLyser II, QIAGEN; Germantown, MD). Aqueous homogenates were profiled using four complimentary liquid chromatography tandem mass spectrometry (LC-MS ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5mM EDTA (pH 8) together with a 5 mm stainless steel bead (Qiagen) and macerated at 1,200 rpm for 2 mins in the Geno/grinder followed by a 10-minute centrifugation (17,000 x g ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... After 8 h we isolated total RNA using a RNeasy Plus minikit (Qiagen). 384 TruSeq Stranded mRNA libraries were prepared in 96 sample batches ...
-
bioRxiv - Developmental Biology 2020Quote: ... HF n=8) using the Qiagen RNeasy Plus Mini Kit (Qiagen, Toronto ON). RNA was quantified by spectrophotometry (DeNovix ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 8) and 30 μl of 20 mg/ml Proteinase K (QIAGEN 19131) were added to the tissue/cell sample and incubated at 55°C overnight ...
-
bioRxiv - Bioengineering 2022Quote: ... cDNA was pooled and 8 ng was combined with SYBR Green Mastermix (Qiagen) for aliquoting into a 384-well RT2 Profiler PCR Array with genes from the Mouse Inflammatory Response and Autoimmunity set (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Plant Biology 2019Quote: ... Sequence files were processed in CLC Genomics Workbench version 8 (Qiagen Bioinformatics, Hilden, Germany); paired Illumina read files and 454 sequencing files were indicated during import ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was isolated from >8 bacterial colonies using QIAprep® Spin Miniprep Kit (Qiagen) and TRIM1 knockout confirmed by sequencing using a T3 forward promoter to confirm truncating stop codons in all copies of the TRIM1 gene present in the genome of selected clones ...
-
bioRxiv - Microbiology 2020Quote: ... Sequences were aligned to the reference viral genome using CLC Sequence Viewer 8 (Qiagen).
-
bioRxiv - Microbiology 2023Quote: RNA was extract from 8 x 106 cells using the RNeasy Mini Kit (Qiagen) protocol ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...