Labshake search
Citations for Qiagen :
1 - 50 of 1249 citations for 8 Chloro pyrido 3 4 b pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Immunology 2020Quote: RNA from isolated fresh B cells and B cells activated with LPS/IL-4 was extracted using a RNeasy kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Biochemistry 2019Quote: ... 3-4 mL of Ni-NTA superflow resin (Qiagen) were loaded onto a column and equilibrated with the resuspension buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... An A base was added to the 3’ ends with Klenow (3’-4’ exo-) (Qiagen). The processed ds-cDNA was then ligated to Illumina sequencing adapters with T4 DNA Ligase (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: ... of healthy (4 weeks of age) and hTNFtg mice (4 & 8 weeks of age) using the RNeasy mini or micro kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in buffer A supplemented with 8 M guanidine hydrochloride (= buffer B) and loaded onto an Ni-NTA agarose column (QIAGEN) pre-equilibrated in the same buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Genomics 2023Quote: Approximately 3-4 million cells were solubilized with 1 mL QIAzol (Qiagen, 79306) and 0.2 mL chloroform in 5PRIME Phase-Lock Gel heavy tubes (QuantaBio ...
-
bioRxiv - Immunology 2021Quote: ... total RNA was isolated from 0.4×106 FACS-sorted B220hi CD138- and B220low CD138+ B cells (derived from 3 biological replicates after eight days in culture) using the RNeasy Mini Kit (Qiagen). cDNA was generated from polyadenylated transcripts employing the SMART-Seq v4 ultra low input RNA kit (Takara Bio) ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was isolated from cSCC cell lines (n = 8) and NHEKs (n = 4) using miRNeasy Mini Kit (Qiagen), and the RNA-seq analysis was performed using Illumina HiSeq2500 system using paired-end sequencing chemistry with 100bp read length (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Cell Biology 2023Quote: ... B) Proteinase K (Qiagen) diluted with PBS to 20 μg·ml-1 final concentration ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs used were: AllStars Negative control siRNA (cat# 1027281) and si-Rab13 #8 (cat# SI02662702; target sequence: 5’-ATGGTCTTTCTTGGTATTAAA-3’) from Qiagen.
-
bioRxiv - Immunology 2022Quote: ... genomic DNA was isolated 3 or 8 days after editing by a QIAamp DNA Mini Kit or Micro Kit (QIAGEN). The genomic region flanking the CRISPR/Cas9 cleavage site was PCR-amplified ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Microbiology 2019Quote: ... 700 μL of cold methanol and 140 μL of EDTA 0.1M were added and vigorously mixed (4 x 45 s) in a mini-bead-beater-8 (Biospec Products, Qiagen). By this way ...
-
bioRxiv - Genomics 2024Quote: ... the Qiagen RNeasy Mini Kit was used according to Qiagen RNA Protect Reagent Handbook Protocols 4 and 7 with Appendix B on-column DNase digestion (Qiagen, Hilden, Germany). The RNA was assessed with UV-Vis spectrophotometry (Denovix DS-11 ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Neuroscience 2022Quote: At DIV 28-30 iPSC-MG from 8 C9orf72 ALS/FTD patient lines and 4 control lines were pelleted and lysed using QIAshredder (QIAGEN-79654) and RNA was isolated with RNeasy Mini Kit (QIAGEN-74104 ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Puregene Core Kit B (Qiagen). Homozygously edited cells were identified using PCR and Sanger sequencing of gel extracted fragments (gel extraction performed using QIAquick Gel Extraction Kit from Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from 3-4 two-week old gemmae using the RNeasy Plant kit (#74903, Qiagen) with RLT buffer supplemented with beta-mercaptoethanol ...
-
bioRxiv - Genetics 2020Quote: ... 4 dpe on-tet n=3) was extracted using the Qiagen RNeasy Mini Plus Kit (Qiagen, Hilden, Germany), which includes a column-based genomic DNA removal step ...
-
bioRxiv - Biochemistry 2023Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... Genomic DNA from 4-8 microdissected 10 μm FFPE sections were extracted using the QIAamp DNA FFPE Tissue kit (Qiagen, cat. no. 56404) according to manufacturer instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... paired-end (37:8:8:38) RNA-sequencing using a RNeasy Micro kit (Qiagen #74004) for RNA extraction ...
-
bioRxiv - Systems Biology 2022Quote: ... Ten millilitres of culture were pelleted by immediate centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Physiology 2023Quote: ... RNA was pooled from 3-4 wells of an MEA plate and then extracted using the miRNeasy kit (Qiagen). RNA levels were measured using the nanoString nCounter® PlexSet™ (nanoString ...
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Genomics 2021Quote: ... or (B) a QIAquick PCR purification column (Qiagen) (proK-col) ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... a cancer associated fibroblast (CAF) cell line (pCAF2) expressing TGF-β responsive SMAD2/3/4 RE-Luciferase (Qiagen, #CLS-017L) was created ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was isolated from approximately 100 EBs (differentiation day 2 and 3) or 25 EBs (differentiation day 4 and 5) using RNeasy Mini kit (Qiagen). 0.5 μg RNA was transcribed to cDNA using QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Immunology 2022Quote: ... Kidneys were mechanically disrupted with metal beads during 3 min at 4°C and DNA was then extracted using QIAmp DNA kit (Qiagen). Leptospiral DNA was specifically targeted using primers and probes designed in the lpxA gene (L ...
-
bioRxiv - Cancer Biology 2022Quote: 3 Type D and 3 Type V SCLC tumor-derived cell lines were treated with either vehicle (EtOH) or 4-OHT for 3 days and RNA was isolated using the RNeasy Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Bioengineering 2023Quote: Genome DNA was extracted from each cell line every 3 – 4 days after transfection or transduction using DNeasy Blood and Tissue Kit (QIAGEN) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...