Labshake search
Citations for Qiagen :
301 - 350 of 2191 citations for 8 5 HEXYL 2 FURYL OCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... nucleic acid extraction was performed using 280 μL of each sample in duplicate by Qiagen viral RNA extraction protocol and quantified RNA was further processed for template preparation using the Ion Chef System ...
-
bioRxiv - Genomics 2020Quote: ... cfDNA was extracted from plasma using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Valencia, California) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... CfDNA was isolated from plasma using the QIAamp Circulating Nucleic Acids kit (QIAGEN, Hilden, Germany) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... CRY2 protein was isolated by Ni2+-nitrilotriacetic acid (Ni-NTA) affinity chromatography (Qiagen, Hilden, Germany) following elution with 50 mM Tris buffer pH 7.5 ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal DNA was extracted using an automated nucleic acid extraction platform called QIAcube HT (Qiagen) with a column-based extraction kit ...
-
bioRxiv - Cancer Biology 2020Quote: Cell-free DNA (cfDNA) was isolated using QIAamp Circulating Nucleic Acid Kit (Qiagen®, Germany) from different volumes of plasma samples (850µl to 2ml) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nucleic acids were extracted from leech samples using the DNeasy 96 Blood & Tissue kit (Qiagen) (see Axtner et al ...
-
bioRxiv - Microbiology 2022Quote: ... nucleic acid was extracted from the tissue sample using QIAamp DNA extraction kit (Qiagen, Germany) as per the recommended protocol ...
-
bioRxiv - Microbiology 2019Quote: ... nucleic acids were extracted using the QIAamp Viral RNA Mini Kit (Qiagen, Germantown, MD USA) with optional on-column DNase treatment according to the manufacturer’s instructions (no carrier RNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tumor nucleic acid extractions were performed using the Allprep DNA/RNA/miRNA Universal kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the QIAamp Circulating Nucleic Acid kit (kit Q; cat# 55114, Qiagen, Germantown, MD, USA).
-
bioRxiv - Microbiology 2020Quote: Total nucleic acid was extracted from respiratory specimens using a QIAamp DNA Mini Kit (QIAgen), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The soluble fraction was passed through 3ml of nickel nitrilotriacetic acid agarose (Ni-NTA) (Qiagen), washed with 20 mM imidazole ...
-
bioRxiv - Genomics 2019Quote: ... Extraction of nucleic acids was performed using the QIamp DNA FFPE extraction kit (Qiagen Ltd.) according to manufacturer’s recommendation.
-
bioRxiv - Cell Biology 2021Quote: The locked nucleic acid-modified oligonucleotides with a fully phosphorothioate backbone were produced by Qiagen as described (Rossiello et al ...
-
bioRxiv - Developmental Biology 2020Quote: DNA was extracted from blood on an automated nucleic acid extraction platform called QiaSymphony (Qiagen) with a magnetic bead-based extraction kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... cfDNA was extracted from 4ml of plasma using QIAamp Circulating Nucleic Acid Kit (QIAGEN, 55114), it was quantified via Qubit Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... His-tagged CSF3R protein was enriched by nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen 30210) and further purified by size-exclusion chromatography on a Superdex 75 10/300 GL column (Cytiva 17517401 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Genomic nucleic acid isolation was performed using the MagAttract HMW DNA Kit (Qiagen, Hilden Germany) precisely following the instructions of the fresh or frozen tissue protocol ...
-
Structure and Neutralization Mechanism of a Human Antibody Targeting a Complex Epitope on Zika VirusbioRxiv - Microbiology 2022Quote: ... Recombinant Fab proteins were purified from the culture supernatant by nickel-nitrilotriacetic acid agarose (Qiagen). Recombinant mAbs were affinity purified by MabSelect resin (Cytiva ...
-
bioRxiv - Genomics 2022Quote: ... Viral nucleic acids were then isolated using QIAamp MinElute Virus Spin Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions with some modifications described (Cosentino et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... A locked nucleic acid probe (mmu-miR-450b-5p miRCURY LNA miRNA Detection probe; Qiagen) was used to detect miR-450b while standard DNA oligonucleotide probes were used for other miRNAs ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and nucleic acid was extracted using EZ1 Advanced XL extraction with a Virus Card (QIAGEN). Six of the 20 FACS populations did not generate sufficient DNA and were not subsequently sequenced ...
-
bioRxiv - Developmental Biology 2023Quote: DNA was extracted from blood on an automated nucleic acid extraction platform called QiaSymphony (Qiagen) with a magnetic bead-based extraction kit ...
-
bioRxiv - Genomics 2024Quote: ... CfDNA was extracted from the plasma samples using the QIAamp Circulating Nucleic Acid Kit (Qiagen) and approximately 3 – 8 ng of cfDNA was isolated from each plasma sample for use in the 5hmC-Seal assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribonucleic acid (RNA) was extracted and purified using RNeasy RNA Isolation Kit (QIAGEN, Germantown, MD) then reverse transcribed into complementary deoxyribonucleic acid (cDNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... total miRNAs were extracted from 8-µm thick FFPE tissues by using a miRNeasy FFPE kit (Qiagen). Among them ...
-
bioRxiv - Genomics 2021Quote: ... The cells were harvested 8-21d post-transfection and genomic DNA and RNA were immediately collected (Qiagen; DNeasy #69504 and RNeasy #74106 ...
-
INTEGRATE: Model-based multi-omics data integration to characterize multi-level metabolic regulationbioRxiv - Systems Biology 2021Quote: Total RNA was extracted from at least 8 x 106 cells by using RNeasy Mini Kit (Qiagen). Each pellet was resuspended by adding 30 μL of RNAse-free water ...
-
bioRxiv - Biochemistry 2020Quote: Initial hits of Nic96186-839-VHH-SAN12 were obtained at 18 °C in 1 day in a 96-well sitting drop tray with a reservoir containing 8% (w/v) PEG 8,000 and 0.1 M tri-sodium citrate pH 5.0 (Protein Complex suite, Qiagen). Hanging drops of 1 ml protein at 6mg/ml and 1 ml of precipitant (7-10% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 8 to 10 independent PCR reactions were pooled together and purified using the PCR purification kit (Qiagen). Multiplexed libraries were sequenced on Illumina HiSeq 2500 to obtain 100 bp single-end reads ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...