Labshake search
Citations for Qiagen :
151 - 200 of 2237 citations for 8 4 dimethylaminophenyl diazenyl N N dimethyl 10 phenylphenazin 10 ium 2 amine chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The N-terminal His-tagged Sif protein (Lmo0946-His6) was expressed and purified using Ni-NTA resin (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... and siCASK #10 (Qiagen cat# SI04437720 ...
-
bioRxiv - Microbiology 2019Quote: ... as per the manufacturer and a final elution step of 2×10 μL EB buffer (Qiagen).
-
bioRxiv - Genetics 2022Quote: ... The PCR amplification was carried out in a 10-μl reaction volume containing 8 μl of Taq PCR Master Mix (Qiagen, Hilden, Germany), 10 μM of each primer (1 μl) ...
-
bioRxiv - Cancer Biology 2021Quote: DNA was isolated from 10-20 8-μm frozen tissue sections of biopsies from humanized mice using the PureGene DNA isolation kit (Qiagen, Hilden, Germany). PCR was performed with six framework region 1 subgroup specific primers and a JH primer mix (3’ JH mix ...
-
bioRxiv - Microbiology 2020Quote: Total RNA extraction was performed using a squash buffer (10 mM Tris base, 1 mM EDTA, 50 mM NaCl) supplemented with 1:8 part Proteinase K (Qiagen, 15mg/ml). Mosquito abdomens with the midguts and heads with thoraces were individually collected in 50 μl of squash buffer at 7 and 14 days ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 minutes 4°C and the supernatant was incubated with pre-equilibrated Ni-NTA agarose beads (Qiagen, #1018244) with shaking on ice for 3 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 sections 10 µm thick were placed in a chilled Eppendorf tube and RNA extraction protocol from Qiagen was performed (Rneasy FFPE Kit 73504 ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant both N-and C-terminally His-tagged proteins were purified using a Ni-NTA Superflow cartridge (1ml, Qiagen) and the Fast Protein Liquid Chromatography (FPLC ...
-
bioRxiv - Microbiology 2020Quote: Bacterial genomic DNA was extracted from overnight (o/n) bacterial liquid cultures with DNeasy® Blood & Tissue Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP ± MirA was loaded onto a column with 80 µL of previously equilibrated Ni-NTA resin (Qiagen) and incubated for 1 h at 4°C with agitation ...
-
bioRxiv - Genomics 2021Quote: ... total RNA was isolated from patient blood samples (CD19+ presorted n=161) using the RNA RNeasy mini kit (Qiagen). RNA quantification was performed with a Qubit 2.0 Fluorometer ...
-
bioRxiv - Cancer Biology 2022Quote: RNA from Nestin(N)/tv-a;Ink4a/Arf-/- neural progenitors was isolated using the RNeasy Kit (Qiagen, Catalog# 74104) and 1μg of total RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... viral RNA was extracted from AFs stocks using the QIAamp MinElute Virus Spin kit (cat. n° 57704, Qiagen, Germany), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... was transformed with an N-terminally His-tagged fusion protein of cytHPPK/DHPS (At1g69190) in the vector pQE30 (Qiagen). Overnight cultures grown at 30°C in LB broth supplemented with 35 µg/mL kanamycin and 100 µg/mL ampicillin were sub-cultured to an OD600 of 0.6 - 0.7 and induced overnight at 16°C with 100 mM isopropyl β-D-1-thiogalactopyranoside ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... of vehicle and Acyl-GIP vehicle treated LDLR−/− mice (n = 5) using Qiazol according to the manufacturer’s instructions (Qiazol Lysis Reagent, QIAGEN). The quality of the RNA was determined with the Agilent 2100 BioAnalyzer (RNA 6000 Nano Kit ...
-
bioRxiv - Microbiology 2022Quote: ... N-terminal His-tagged SlPR1 and SlChi3 proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA extraction of gill tissue (N = 16 individuals per population) was performed using the DNeasy Blood & Tissue Kit (Qiagen). Further purification of the extracted DNA was done with NucleoSpin® gDNA Clean-up (Macherey-Nagel) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Those PDTOs that underwent FOLFOX treatment (n=14) had RNA extracted using the Qiagen RNAeasy micro kit (Qiagen, # 74004).
-
bioRxiv - Microbiology 2020Quote: Following 72 h post treatment with a sublethal concentration of compound 33 (3.13 µM), adult male worms (n = 20 worms, three biological replicates) were homogenized with a TissueLyser (Qiagen) and total histones extracted using the EpiQuikTM Total Histone Extraction kit (OP-0006 ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was isolated from dissected brains (n = 9 brains per experimental cohort) by RNeasy Mini Kit (Qiagen, 74104), with on-column removal of genomic DNA (Qiagen ...
-
bioRxiv - Immunology 2023Quote: RNAseq was performed on total PBMCs from n=36 individuals in our cohort using the AllPrep kit as per manufacturer’s instructions (Qiagen). RNA libraries ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... About 30-40 flowers were pooled together from 8-10 different plants for each biological repeat and RNA was isolated using RNAeasy plant mini kit (Qiagen, Germantown, MD, USA). RNA was converted to cDNA using PrimeScript RT Master Mix (Takara) ...
-
bioRxiv - Immunology 2020Quote: ... in purity mode into 96-well microplates containing 10 μL of 1% 2-mercaptoethanol RLT buffer (Qiagen) and stored at −80°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and homogenized twice at 10 s at 2 M/s with a 5-mm steal bead (Qiagen) using a tissue homogenizer (MP Biomedicals) ...
-
bioRxiv - Genomics 2021Quote: ... in a 20 μL system with a mixture of 10 μL 2×SYBR Premix ExTaq (Qiagen, Germany), 2.0 μL diluted cDNA or double distilled water as a negative control ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 mM Tris pH 8.5, 2 mM MgCl2, 0.5% NP40, 0.5% Tween20, 0.05 U/mL QIAGEN protease) and following the procedure described in (42) ...
-
bioRxiv - Cell Biology 2021Quote: ... of healthy (4 weeks of age) and hTNFtg mice (4 & 8 weeks of age) using the RNeasy mini or micro kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... medium at 37°C and was made competent with rubidium chloride according to the method provided in the QIAexpressionist manual protocol 2 (Qiagen). When antibiotic selection was required ...
-
bioRxiv - Genomics 2020Quote: ... 10 µl Proteinase K (Qiagen), and 70 µl Digestion buffer (20mM EDTA ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μl RDD buffer (QIAGEN) and 4 μl DNase I (QIAGEN ...
-
bioRxiv - Cell Biology 2021Quote: Tissue lysates were further homogenized and centrifuged at 10,000 g for 10 min at 4°C in microcentrifuge spin columns (QIAshredder, Qiagen) to obtain clear protein lysate ...
-
bioRxiv - Molecular Biology 2022Quote: His-Prs or its variants (10 µg) were bound to 4 µl of Ni-NTA Magnetic Agarose Beads (Qiagen) in 50 µl interaction buffer (50 mM Tris pH 9.0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from heparinised blood of SI and SH mice (n=3 per housing group) using the RNeasy Protect Animal Blood Kit (Qiagen). Extracted RNA was hybridised at UCL genomics following standard Affymetrix protocols ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from blood (n=6 for each housing group) using the RNeasy Protect Animal Blood Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: Whole blood samples from 10 healthy volunteers (n = 5 females and n = 5 males) aged from 25 to 37 were collected into PAX gene RNA blood tubes (Qiagen). Total RNA samples were isolated using QIAcube automation with the PAXgene Blood miRNA Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... PRRSV-2 RNA was used to amplify cDNA encoding the full-length of N gene by RT-PCR (One-step RT-PCR, QIAGEN) using specific primers with the forward containing a T7 promoter sequence at the 5’ end ...
-
bioRxiv - Microbiology 2019Quote: ... coli BL21 (DE3) as fusion proteins containing an N-terminal His6- tag and purified by immobilized metal-affinity chromatography (Ni-NTA, Qiagen). Full-length DosR was also expressed with N-terminal GST-tag ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA from ∼250,000 neurons per sample (n = 3 samples per group) was extracted and purified (DNeasy Blood and Tissue DNA extraction kit, Qiagen) prior to RRBS (Ovation RRBS Methyl-Seq System ...
-
bioRxiv - Biophysics 2020Quote: ... All the constructs also contain a His6-tag at the N-terminus for affinity purification with Nickel-NTA agarose beads (Qiagen). Site-directed mutagenesis was performed using the QuickChange Lightning kit (Agilent Technology) ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant protein fragments were produced in Escherichia coli (strain M15) as fusion products with an N-terminal tag of six histidines using plasmid pQE30 (Qiagen) and purified from total bacterial lysates by nickel affinity chromatography ...
-
bioRxiv - Cancer Biology 2022Quote: Spheroid and monolayer samples (technical replicates n=3) of MUC-1 and NCI-H295R cells were processed for RNA extraction using the RNeasy Mini kit (Qiagen), followed by DNA removal (TURBO DNA-free™ Kit ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from single-cell clone or bulk GFP+ and GFP- cells (n = 3 with cells from three different mice in each group) using QIAzol lysis reagent (Qiagen). DNA was removed using the RNase-Free DNase Set (QIAGEN) ...
-
bioRxiv - Neuroscience 2019Quote: ... was extracted from P7 dissected neocortices separated from meninges of Ctrl and Nr2f1cKO mice (n=3) using the RNeasy Mini kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA was extracted from control and INPP5ED477N/D477N organoids (n=3 samples per genotype) using an RNeasy Plus Micro Kit (Qiagen) and reverse transcribed using Superscript™ IV VILO™ Master ezDNase enzyme (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2020Quote: ... Cells were transiently transfected with cDNA encoding the mouse Piezo1 channel or its mutants tagged with GFP on its N-terminus in the pCDNA3 vector using the Effectene reagent (QIAGEN). Cells were then trypsinized and re-plated on poly-D-lysine-coated round coverslips 24 hours after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... and digested DNA products were extracted from the agarose gel using the QIAquick Gel Extraction kit (QIAGEN, cat. n° 28704), according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... Cell debris were removed by centrifugation (35,000 g at 4°C for 20 min) and the N-terminal His-tagged proteins were purified from the supernatant using NiNTA agarose (Qiagen) according to the manufacturer’s instructions ...