Labshake search
Citations for Qiagen :
51 - 100 of 2506 citations for 7H Benzocyclohepten 7 one 2 amino 5 6 8 9 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Genomics 2023Quote: ... Cell-free RNA was isolated from between 2-8 mL following manufacturer’s instructions (Qiagen, 55114). Isolated RNA was DNase-treated (Lucigen ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... CD11b+ CD45+ cells from one animal (2 retinas) were sorted directly into RLT buffer (QIAGEN 79216) and stored at -80°C ...
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid expressing VSV-G or HIVKB9 envelope glycoproteins were cotransfected at the mass ratio of 9:1 (9 Hi.fate / 1 Env) using Effectene (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 5 or 6 Transwells using the RNeasy Micro Plus kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...
-
bioRxiv - Bioengineering 2023Quote: ... DNA was extracted in pools of 6-8 adult mosquitoes mosquitoes using Blood & Cell Culture DNA Midi Kit (Qiagen, Cat# 13343) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from pooled ipsilateral lumbar (L4-6) DRGs from one rat using the Qiagen RNeasy Mini Prep Kit (Qiagen, Valencia, CA) with on-column DNase digestion (Qiagen ...
-
bioRxiv - Physiology 2020Quote: We extracted RNA from 35 pituitaries and 35 gonads (17 Independents, 9 Satellites, 9 Faeders) using the RNeasy Minikit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: ... and chestnut oak with FUSE (n = 9) and conventional extraction methods (n = 9) using a lysis buffer and purified using silica columns (Qiagen DNeasy Plant Kit Qiagen Inc ...
-
bioRxiv - Microbiology 2022Quote: ... coli strains containing expression plasmid pQE-9 (Qiagen), pQE9-ftsA ...
-
bioRxiv - Microbiology 2023Quote: ... and the CLC Genomics Workbench 9 software (Qiagen) for analysis ...
-
bioRxiv - Immunology 2023Quote: ... Samples were diluted 9:1 (elution buffer (Qiagen):cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: 2 × 105 cells were reverse-transfected in 6-well plates with Flexitube siRNA constructs (Qiagen) targeting KEAP1 (KEAP1_5 or KEAP1_8) ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng equivalent of pooled total RNA (5 slices per animal; 7 rats) was used to synthesize cDNA using an RT First Strand Kit (Qiagen). Pre-validated primers targeting rat CXCR4 ...
-
bioRxiv - Neuroscience 2020Quote: RNA was extracted from third-instar larval CNS or adult heads (5-7 days post-pupation) with RNeasy Plus Micro kit (Qiagen). RNA isolation was followed with DNase digestion with Turbo DNA-free (Ambion) ...
-
bioRxiv - Cell Biology 2019Quote: ... The reaction was stopped using 15mM EDTA followed by incubation at 65°C for 5-7 min and purification on RNAeasy column (Qiagen). The purified RNA samples were processed for preparations of cDNA libraries using the TruSeq Stranded Total RNA Ribo-Zero H/M/R (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... and microbial Eukaryotic abundance with a QIAcuity One 5-plex digital PCR (dPCR) instrument (Qiagen Inc. USA, Germantown, MD). dPCR samples represented both the 416 Fire —across SBS ...
-
bioRxiv - Immunology 2020Quote: ... which contained 5 μl of sort buffer consisting of (1X Qiagen One-step RT PCR Buffer (Qiagen, Hilden, Germany), 0.1 mM dithiothreitol (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... 14-666-315) containing 1 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Nucleic acids were isolated from excised granulomas by homogenizing in TRIzol (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... and 9 dpi with a RNeasy Mini Kit (Qiagen) with DNase treatment ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated from 5-6 replicated lung slices from each treatment using miRNeasy Mini Kit (Qiagen) at time 0 and time 120 hours for all groups ...
-
bioRxiv - Plant Biology 2021Quote: RNA was extracted from root tips (1-2 mm) of 7-d-old seedlings using the RNEasy plant mini kit (QIAGEN), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: Total mRNA was isolated from 2 dpf or 7 dpf zebrafish homogenates using the RNeasy Mini Kit (Qiagen, Cat# 74104) and reverse-transcribed with SuperScript VILO (ThermoFisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was stopped by adding 2.5 uL of 0.5M EDTA pH 8 and transposed DNA was purified using Qiagen MiniElute PCR purification kit (Qiagen). Purified DNA was amplified using the following condition ...
-
bioRxiv - Microbiology 2022Quote: ... One volume of bacterial culture containing approximately 0.2 OD600 of cells was mixed with 2 volumes of RNAprotect (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... One half of clarified cell lysate (2 ml) was applied to 200 μl of Ni-NTA Superflow resin (Qiagen) equilibrated with Ni wash buffer (20 mM HEPES pH 8.0 ...
-
bioRxiv - Bioengineering 2021Quote: ... Total RNA (5 μl) was used for cDNA synthesis and qPCR was performed in one step using QuantiTect Probe RT-PCR (Qiagen) on a StepOnePlus System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl RNA was used in a one-step real-time RT-PCR using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: ... The eluted RNA from tissues and swabs was analyzed by one-step qRT-PCR using 5 μL input RNA with the QuantiFast Probe PCR kit (Qiagen) and primer/probe sets targeting the NiV Malaysia and HeV N gene ...
-
bioRxiv - Microbiology 2023Quote: ... calf muscle and pancreas were collected in 500 μl of PBS containing one (heart and pancreas) or two (calf muscle) 5 mm stainless steel beads (QIAGEN), homogenized with TissueLyser II (QIAGEN ...
-
bioRxiv - Microbiology 2021Quote: ... 6 (Qiagen) for additional analysis ...
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Plant Biology 2023Quote: ... unexpanded leaves was extracted from 14 individuals (7 early-blooming, 5 late-blooming, and the two parents) with a DNeasy Mini Plant Kit (Qiagen, Hilden, Germany) and quantified with a Quant-iTTM PicoGreenTM dsDNA assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... The pure genomic DNA was sheared by ultrasound and 2-8 kb fragments were extracted from a 0.7% agarose gel using the Gel Extraction Kit (Qiagen). The gel-recovered fragments were ligated to the linearized PZE12 vector (prime 3,4 ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs used were: AllStars Negative control siRNA (cat# 1027281) and si-Rab13 #8 (cat# SI02662702; target sequence: 5’-ATGGTCTTTCTTGGTATTAAA-3’) from Qiagen.
-
bioRxiv - Microbiology 2021Quote: ... a volume equivalent to 5×108 cells were spun down (assuming 1 OD600=8×108 cells) and Protect Bacteria RNA Mini Kit (Qiagen) was used to extract total RNA as described in (Bhattacharyya et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... The frozen brain tissue blocks of WRM and BF were boiled for 8 min and homogenized in 5% acetic acid using a TissueLyser LT (Qiagen) for 6 min at 50 Hz ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA for PIWIL3 5′ RACE was extracted from the ovaries of 8-week-old golden hamsters using ISOGEN (Nippon Gene) and RNeasy (Qiagen). 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio ...
-
bioRxiv - Microbiology 2021Quote: ... 10 µl of the cell suspension from each dilution was dispensed into 24 wells of a 96 well plate containing 2 μl One-step RT-PCR enzyme (Qiagen), 10 μl 5x One-step RT-PCR buffer (Qiagen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the sample was divided into 5 parts and each part was purified using one PCR purification columns (PCR purification kit, Qiagen 28106). 50ul elution buffer was used the elute each column ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 ng of each PCR product was pooled into one tube for purification using the QIAquick PCR purification kit (Qiagen #28106) and eluted into 30 µL Nuclease Free Water ...
-
bioRxiv - Genomics 2022Quote: ... One mL of Qiazol (Qiagen) was added to an aliquot of 150 μl of plasma per sample ...
-
bioRxiv - Immunology 2023Quote: ... One stainless steel bead (Qiagen) was added per sample and liver tissues were homogenized using the TissueLyser LT (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Barcoded libraries (One-step, Qiagen) were then run on MiSeq or NextSeq Illumina sequencers ...
-
bioRxiv - Pathology 2022Quote: ... with stainless steel beads (2×5 mm) using a TissueLyser (Qiagen, Germantown, MD) for three minutes at 25 r/s twice ...