Labshake search
Citations for Qiagen :
151 - 200 of 3780 citations for 7 chloro 5 2 fluorophenyl 4 hydroxy 3H 1 4 benzodiazepin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Each qPCR reaction consisted of 5 μL of 2× QuantiNOVA SYBR Green PCR master mix (Qiagen), 0.5 μL of 10 μM forward and reverse primers each ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Bioengineering 2023Quote: ... on a 5-plex QIAcuity One digital PCR instrument (Qiagen, 911021). The thermal cycling conditions were implemented using the following program ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... n=4 females [hybrid cross] and n=5 females [conspecific cross]) using the AllPrep RNA/DNA Mini Kit (Qiagen), and was stored at −80°C until sequencing ...
-
bioRxiv - Systems Biology 2022Quote: ... Ten millilitres of culture were pelleted by immediate centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The supernatant was 0.2 µM filtered and was incubated overnight at 4°C with 5 mL of Ni-NTA beads (Qiagen). XXX
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 4 µg RNAseA/ml (Qiagen 158922)] and placing cells on ice for 20 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 µg of RNaseA (Qiagen 28306) overnight as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... the detection of N-gene of SARS-CoV-2 was performed by using the 2019-nCoV-2 RUO kit (Integrated DNA Technologies, Inc., Coralville, Iowa, USA) and One-Step RT-PCR Kit (QIAGEN® GmbH) on a Rotor-Gene Q real-time PCR cycler (QIAGEN® GmbH) ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... placed into a 2 mL tube with 600 μL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989), then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... 14-666-315) containing 1 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Nucleic acids were isolated from excised granulomas by homogenizing in TRIzol (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... His6-SUMO-WASHC2C-5-SNAP was purified using lysis buffer #2 and Ni-NTA-agarose beads (Qiagen). The protein was incubated with Ni-NTA beads and washed with 50 mM imidazole ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and homogenized twice at 10 s at 2 M/s with a 5-mm steal bead (Qiagen) using a tissue homogenizer (MP Biomedicals) ...
-
bioRxiv - Genomics 2024Quote: RNA was extracted from 2-5 million flash frozen cells using the RNeasy plus mini kit (Qiagen). Libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (New Englands Biolabs) ...
-
bioRxiv - Plant Biology 2021Quote: ... nks1-1 and nks1-2 using RNeasy Plant mini kit (74904, QIAGEN). cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691 ...
-
bioRxiv - Genetics 2020Quote: ... rad54-1 and rad54-2 plants using RNeasy Plant mini Kit (QIAGEN), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... The samples then had a 2:1 ratio of RNAprotect (Qiagen: #76506) added to them and centrifuged at 5,000 RCF for 10 min ...
-
bioRxiv - Biophysics 2022Quote: ... combined with Ni-NTA resin (2 mL/1 L of biomass, Qiagen) pre-equilibrated with 40 mM sodium phosphate buffer ...
-
bioRxiv - Microbiology 2023Quote: ... each treated culture was mixed 1:2 with RNA Protect (Qiagen, Germany), vortexed for 10 seconds ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... Nasal turbinates and lungs were collected from a subset of hamsters at 4 dpi and homogenized in 1ml or 5 ml of PBS with TissueRuptor (Qiagen), respectively ...
-
bioRxiv - Genetics 2022Quote: Total RNA was extracted from the stomach and pyloric caeca tissue samples stored at -80 °C (n = 4 for control and fly larvae, n = 5 for shrimp shell) using the RNeasy Plus Universal Kit (QIAGEN). RNA quality was assessed using a 2100 Bioanalyzer with the RNA 6000 nano kit (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... and adult females (approximately 4-5 of each) were prepared for RNAseq using the RNeasy Blood and Tissue Kit (Qiagen). Individuals were placed in a 1.5 mL safelock tube along with 5-8 one mm glass beads placed in liquid nitrogen and then shaken for 30 s in a Silamat S6 shaker (Ivoclar Vivadent) ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were pelleted at 350 x g for 5 min at 4 °C and lysed in 350 μl RLT buffer of the RNeasy Mini Kit (Qiagen). RNA was isolated according to the manufacturer’s instructions ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Lysates were cleared by centrifugation at 15000 x g for 30 min at 4 °C and incubated in Pierce 5 ml columns with Ni-NTA agarose beads (Qiagen) at 4 °C for 1 h ...
-
bioRxiv - Genomics 2020Quote: ... and 3-week-old) and leaves (4-, 5-, and 6-week-old plants) was isolated and purified using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: mRNA was isolated from Boyden chamber migration assay-derived Treg pellets from 5 HD and 4 uRRMS patients using RNeasy micro kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated for 30 min at 4 °C with 5 mL of Ni2+-beads (Qiagen Ni-NTA Superflow) equilibrated in lysis buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... one 5 mm bead per sample was used in a TissueLyser (Qiagen) for 4 min at 30 Hz ...
-
bioRxiv - Bioengineering 2023Quote: ... on a 5-plex QIAcuity One digital PCR instrument (911021, Qiagen, USA). The thermal cycling conditions were implemented using the following program ...
-
bioRxiv - Genomics 2019Quote: ... cfDNA was extracted from 1 or 4 ml of urine according to manufacturer recommendations (Qiagen Circulating Nucleic Acid Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 °C) and the supernatant was then loaded onto 1 ml HisTrap HP column (Qiagen) at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... the supernatant was incubated for 1 hour at 4°C with Ni-NTA-agarose (Qiagen), washed several times with lysis buffer and the protein was eluted by incubation for 3 hours with lysis buffer containing 500 mM imidazol ...
-
bioRxiv - Genomics 2023Quote: ... Button valves were opened and biotinylated anti-pentaHis antibody (Qiagen, 1:4 dilution in HEPES) was flowed for 30 minutes ...
-
bioRxiv - Genetics 2020Quote: ... approximately 30 seeds per genotype were placed in a 2 mL Eppendorf Safe Lock tube along with one stainless steel bead (Qiagen Cat. No. 69989), frozen in liquid nitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... 5.6 x 105 cells were seeded in 4 ml DMEM in a 6-cm culture plate and transfected with targeting or control siRNA (Table 4) (from Qiagen) to a final concentration of 20 nM for each siRNA used ...
-
bioRxiv - Cell Biology 2021Quote: ... of healthy (4 weeks of age) and hTNFtg mice (4 & 8 weeks of age) using the RNeasy mini or micro kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: SUZ12 isogenic M3 MPNST cells were treated with or without DNMT inhibitors (50 nM daily Decitabine or 4 μM single dose of GSK862) for 4 days followed by genomic DNA isolation with Gentra Puregene cell kit (Qiagen). Bisulfite sequencing was conducted by the IGO core facility at MSKCC ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted from infected (n = 4) and control (n = 4) bAM samples using the RNeasy Plus Mini Kit (Qiagen) as previously described [91] ...
-
bioRxiv - Cell Biology 2023Quote: ... ULK2 (mixture of 4 siRNAs, GS9706), TBC1D14 (mixture of 4 siRNAs, GS57533) and non-targeting (NT, # 5091027310) were purchased from Qiagen.
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase Inhibitor (4 unit/µl) (cat # 1055213, Qiagen), rRNasin Rnase inhibitor (40 U/µl ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 4) DNeasy Plant Mini Kit (QIAGEN®) combined with the InhibitEx Buffer step from the QIAamp DNA Stool Mini Kit to improve inhibitor removal ...
-
bioRxiv - Microbiology 2019Quote: ... 4 µg/mL DNase I (QIAgen, Hilden, Germany), 2 µg/mL RNase A (QIAgen) ...