Labshake search
Citations for Qiagen :
551 - 600 of 1018 citations for 7 bromoquinoline 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Extractions of viral nucleic acids from 140 µl samples were performed with the QIAamp Viral RNA Mini Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The kidneys were homogenized using 0.5 M acetic acid and two 5-mm steel beads in TissueLyser LT (Qiagen), followed by addition of pepsin to 0.1 mg/ml and incubation for 3 days ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were moved on magnet and supernatant was transferred to clean 1.5 mL tubes for nucleic acid extraction using the MinElute PCR Purification Kit (Qiagen). Purified DNA was used for library preparation using the NEBNext Ultra Library prep Kit (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The clarified supernatant was passed through the pre-equilibriated nickel-nitrilotriacetic acid (Ni-NTA) beads (Qiagen, Germantown, MD, USA) in a gravity flow column ...
-
bioRxiv - Microbiology 2023Quote: We extracted nucleic acids from each 200 μL aliquot using the AllPrep PowerViral DNA/RNA kit (Qiagen, Hilden, Germany) using Glass PowerBead tubes included with the kit ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was filtered through a 0.45 μm Millex-HV PVDF membrane and loaded on a nickel-nitrilotriacetic acid column (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: Sequences comparisons between 16S rRNA and bsh genes/BSH amino acid sequences were performed in CLC Genomics Workbench (Qiagen). 7α-HSDH sequence comparisons were performed using tblastn78 using the translated amino acid sequence from Clostridium absonum44.
-
bioRxiv - Microbiology 2023Quote: ... Three nucleic acid extraction kits designed for DNA and RNA extraction were compared: DNeasy PowerWater kit (QIAGEN; Hilden, Germany), NucleoSpin Soil ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Hybridization was performed at 66 °C overnight with 40 nM 5′ TYE-563-labelled locked nucleic acid (LNA)-(C4G2)2.5 probe (Exiqon Qiagen). Cells were then washed once in 2X SSC/0.1% Tween-20 for 5 minutes and three times in 0.1X SSC for 10 minutes at RT before being dehydrated as above and nuclei stained with DAPI.
-
bioRxiv - Developmental Biology 2021Quote: ... het and KO mice (3 each) by RNeasy Micro Kit with DNase I (Qiagen). Quality control was done by Qubit RNA assay ...
-
bioRxiv - Immunology 2019Quote: ... Human RAC2 3’UTR was amplified with One Step Ahead RT-PCR kit (Qiagen) from human mRNA using the following primers RAC2 3’UTR+ ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 mL of culture were mixed with 6 mL of RNAprotect bacteria reagent (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... the media was collected and applied to 3 ml of Ni-NTA resin (Qiagen). The resin was collected and washed with PBS supplemented with 20 mM imidazole ...
-
bioRxiv - Bioengineering 2020Quote: ... 0.001 M of HCl at pH 3 was added and then homogenized (TissueRuptor, Qiagen) on ice ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were reverse transfected with 5 pmol of each siRNA (QIAGEN) using lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Biochemistry 2021Quote: ... cells or tissues were lysed using a TissueLyser II (3 min, 30 Hz; Qiagen) in RIPA buffer (150 mM NaCl (Merck) ...
-
bioRxiv - Plant Biology 2021Quote: Plant tissue was disrupted mechanically using 3 mm tungsten carbide beads (Qiagen, Hilden, Germany), and a TissueLyser II (Quiagen ...
-
bioRxiv - Immunology 2019Quote: ... 3 times and then eluted with 350 uL of buffer RLT (Qiagen RNeasy kit). Input and immunoprecipitated RNA was purified on column (Qiagen RNeasy kit ...
-
bioRxiv - Plant Biology 2022Quote: ... from Brachypodium Bd21-3 genomic DNA extracted using the DNeasy Plant Mini Kit (Qiagen) or specific plasmids using primers that contained Type IIS restriction sites and overhangs complementary to the respective entry module ...
-
bioRxiv - Microbiology 2023Quote: ... contaminated DNA was digested by 3 times treatment with RNase-Free DNase Set (Qiagen), and the absence of DNA contamination in extracted RNA was confirmed by PCR.
-
bioRxiv - Molecular Biology 2022Quote: RNA was extracted from six hundred testes of ≤3 days old using miRNeasy (QIAGEN). Less than 200 nt fragments were collected using miRelute column (QIAGEN) ...
-
bioRxiv - Genetics 2023Quote: ... and a single 3 mm metal bead (Eldan, BL6693003000) using TissueLyzer LT (QIAGEN, #85600) with a dedicated adaptor (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: ... for 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). Vero cells were seeded in 24-well plates and incubated for 24 hours to reach confluency ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were sorted into 384 well plates each containing 3 μl Vapor-Lock (Qiagen) in all wells and eight different conditions of 0.3 μl lysis buffer consisting of 0.125μM OligodT30VN (5’-Biotin-ACGAGCATCAGCAGCATACGAT30VN-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Microbiology 2019Quote: Total RNA was extracted from frozen samples using two acid phenol-chloroform-isoamyl alcohol extractions and immediately purified using the RNEasy MinElute kit (Qiagen). Ribosomal RNA (rRNA ...
-
bioRxiv - Genomics 2019Quote: ... Four hundred µL of 70% ethanol were added and nucleic acid extraction was immediately done with the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... We extracted total genomic DNA from blood and/or tissue samples using standard nucleic acid extraction kits (QIAamp DNA Mini Kit; Qiagen) automated on a QiaCube (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 nucleic acids were isolated from 300 µl viral transport media using the QIAamp Viral RNA Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were purified under denaturing conditions by nickel-nitrilotriacetic acid (NTA)-agarose affinity chromatography as described by the manufacturer (Qiagen). Polyclonal rabbit antisera were raised by Covance Research Products Inc ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted from stool samples using the RNeasy PowerMicrobiome kit automated on the QIAcube (Qiagen, Germantown, MD, USA), excluding the DNA degradation steps ...
-
bioRxiv - Microbiology 2021Quote: ... Total Nucleic Acid (TNA) was extracted from using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (Qiagen). Autopsy tissues were collected from lung ...
-
bioRxiv - Biophysics 2021Quote: ... MHC II with C-terminal hexahistidine tags on both α and β chains were expressed using a baculovirus expression system in S2 cells and purified using a Ni–nitrilotriacetic acid (NTA) agarose column (Qiagen). The histidine-tagged MHC bacmid (Malherbe et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant obtained after high speed centrifugation (20 000 x g for 30 min at 4 °C) was loaded on a gravity nickel-nitrilotriacetic acid (Ni-NTA) metal affinity column (Qiagen), washed with 10 column volumes (CV ...
-
bioRxiv - Molecular Biology 2020Quote: ... the supernatant was added to 2 ml of pre-equilibrated Nickel-nitrilotriacetic acid (Ni-NTA) agarose (QIAGEN, Cat. No. 30210) 50% slurry and rotated at 4°C for 2 h ...
-
bioRxiv - Microbiology 2020Quote: ... the samples were diluted further with RTL buffer to give a 1:60 w/v homogenate and total nucleic acid was extracted from 300 μl of the clarified sample using the RNA tissue mini kit without DNase (Qiagen) and eluted in a 60 μl volume.
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from yeast cells using either the acid phenol-chloroform method or an RNeasy Mini kit with on-column removal of DNA (Qiagen), both as previously described 28 ...
-
bioRxiv - Genomics 2021Quote: ... cfDNA extraction was performed using the QIAamp Circulating Nucleic Acid Kit using the 4-mL plasma protocol (Qiagen, product #55114). Prior to DNA elution ...
-
bioRxiv - Neuroscience 2022Quote: For the functional validation of the miR-124/Zfp36l1 interaction a custom made miRCURY locked nucleic acid (LNA) miRNA Power Target Site Blocker (TSB) (Qiagen) was used with the following sequence ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Biophysics 2022Quote: ... Supernatants were incubated with glutathione Sepharose (GSH) fast flow beads (GE-Healthcare) for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: Total viral RNA was extracted from deactivated samples using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (QIAGEN). One step reverse transcription to cDNA and real-time PCR (RT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: A locked nucleic acid (LNA) oligonucleotide probe antisense for the mature form of miR-92a-3p was designed and produced by Qiagen. The probe sequence was ACAGGCCGGGACAAGTGCAATA ...
-
bioRxiv - Biochemistry 2019Quote: ... and the lysate was mixed gently with 4 ml (50% slurry) of nickel-nitrilotriacetic acid (Ni-NTA)-agarose resin (Qiagen) at 4°C for 1 h ...
-
bioRxiv - Plant Biology 2019Quote: ... Supernatant was applied twice to a column containing a gel bed of 2 ml nickel-nitriloacetic acid agarose (Qiagen, www.quiagen.com) equilibrated with lysis buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... we utilized 4 mL of plasma and cfDNA was isolated using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany). The concentration of cfDNA was determined using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... Nucleic acids were purified from the lysates using the Qiagen AllPrep DNA/RNA mini kit (Qiagen Inc., Valencia, CA, USA), quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific ...