Labshake search
Citations for Qiagen :
1 - 50 of 3255 citations for 7 bromo 1 methyl 1 3 dihydro 2H benzo d imidazol 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: RNA was extracted from root tips (1-2 mm) of 7-d-old seedlings using the RNEasy plant mini kit (QIAGEN), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 x 2 minute intervals at 25 Hz with the addition of one 7 mm stainless steel bead (Qiagen #69990). 200 uL of tissue lysate was used for KingFisher Flex (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Immunology 2021Quote: ... Twenty consecutive 10 μm sections were placed on glass slides for subsequent IHC (sections 1-2, 7-8, 13-14, & 19-20) or placed in 600 μl buffer RLT (Qiagen) containing 1% 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Physiology 2023Quote: ... Ganglia in 1 mL of TRIzol reagent were homogenized using a TissueLyzer II bead mill (one 5 mm stainless steel bead per tube, 30 s-1 frequency for 3 minutes; Qiagen Inc. Hilden, Germany). The homogenates were incubated with 200 µL chloroform and centrifuged for 15 minutes at 12000 x g to isolate the protein-containing organic phase ...
-
bioRxiv - Genomics 2022Quote: ... Trachea was dissected and immersed in 1 mL PBS in a 2 mL microcentrifuge tube (Fisherbrand, 14-666-315) containing one stainless steel bead (QIAGEN, 69989). After the homogenization ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Genetics 2023Quote: ... Further confirmation of which allele was deleted in clones with only one UBE3A copy was performed by utilizing the EpiTect Methyl II DNA Restriction Kit (QIAGEN, #335452) to measure methylation at the PWS-IC (SNRPN ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Neuroscience 2022Quote: Tissue cultures that were cultivated on one filter membrane (3 cultures) were transferred as one sample into RLT buffer (QIAGEN) and RNA was isolated according to the manufacturer’s instructions (RNeasy Plus Micro Kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Microbiology 2020Quote: ... were homogenized 7 min at 50 pulses s-1 with the Tissuelyser LT (QIAGEN) prior to incubation in lysis buffer for 1 h at 60°C for increasing cell lysis ...
-
bioRxiv - Biochemistry 2022Quote: IQN17 was crystallized at room temperature in a hanging-drop vapor diffusion system by mixing 0.3 μL of 15 mg/mL peptide with 0.3 μL of reservoir solution containing 0.1 M imidazole (pH 8.0) and 35 % 2-methyl-2,4-pentanediol (MPD) (Qiagen). Crystals were seen two days after trays were set up ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl Proteinase K (Qiagen, RP107B-1) and 5 µl water was added to each tube with 5 µl sub-library for a final volume of 20 µl per reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... thresholds were used to prepare Reduced Representation Bisulfite Sequencing (RRBS) libraries using the Ovation RRBS Methyl-Seq System 1-16 (NuGen) and the EpiTect Fast DNA Bisulfite kit (Qiagen). Libraries were sequenced using the NextSeq500 platform (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 μg DNA ratio using Effectene transfection reagent (Qiagen). Recombinant luciferase-expressing viruses capable of a single round of replication were released into the cell medium and were harvested 48 h later ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 µg DNA ratio using effectene transfection reagent (Qiagen). Recombinant ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Neuroscience 2024Quote: ... we harvested 1 Mio cells or one organoid in RLT buffer (#74104, Qiagen, Germany). cDNA was synthesized with the RevertAid Reverse Transcriptase kit (EP0442 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was obtained and amplified in a first-round PCR (RdRpS1 5’-GGKTGGGAYTAYCCKAARTG-3’, RdRpR1 5’-TGYTGTSWRCARAAYTCRTG-3’) using One-Step RT-PCR Enzyme MixKit (Qiagen) with the total expected size of 602 base pairs (bp) ...
-
bioRxiv - Genomics 2024Quote: ... RNA was first amplified using a first-round PCR (RdRp S1 5ߣ-GGKTGGGAYTAYCCKAARTG -3’, RdRp R1 5’-TGYTGTSWRCARAAYTCRTG-3’) with the One-Step RT-PCR Enzyme MixKit (Qiagen), targeting a total expected size of 620 base pairs (bp) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we homogenized 2-3 fecal pellets in 1 mL H2O using ceramic beads (NucleoSpin, Macherey–Nagel, Dueren, Germany) and a TissueLyser (Qiagen, Hilden, Germany), mixing the sample for 3 × 30 s at 4,500 rpm with a 10 s cooling break (< 0°C) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 1 μM Locked Nucleic Acid (LNA) oligo-d(T)30 (Qiagen) in primary-probe hybridization buffer composed of 40% formamide (Sigma ...
-
bioRxiv - Genomics 2020Quote: ... cells were mixed 1:2 with RNAProtect (Qiagen) and harvested via centrifugation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Epitect Methyl II PCR Array System (Qiagen) was used to determine the CpG island methylation status of CDH1 (E-Cadherin) ...
-
bioRxiv - Neuroscience 2022Quote: EpiTect Methyl II PCR Primer Assay (Qiagen) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... was achieved from frozen tissue biopsies upon homogenization with stainless steel beads (3–7 mm mean diameter) using TissueLyser II (QIAGEN; 20” at 30 Hz, for 2 cycles(20)) ...
-
bioRxiv - Microbiology 2024Quote: ... (NM-2) one negative control for the kit DNeasy Blood and Tissue (Qiagen) used for DNA extraction of minipig blood and (NM-3 ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL (50U) of high-concentration klenow 3’-5’ exo-polymerase (Qiagen) was added ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or a 3:2 mixture of QG buffer (QIAGEN) and isopropanol ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Genomics 2020Quote: ... for 2h and purified by column purification (MinElute PCR Purification Kit, Qiagen). The fragment was digested with EcoRI and XbaI restriction enzymes (FastDigest ...
-
bioRxiv - Microbiology 2024Quote: ... Biomass was immediately stabilized upon sampling by mixing 2 ml biomass with 6 ml PowerProtect DNA/RNA solution (1:3) (Qiagen Benelux B.V., Venlo, The Netherlands). The stabilized mixture was spun down and the remaining pellet was freeze-dried overnight and stored at −70°C ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from MCF-7 cells (1×106 cells/well) was isolated using RNeasy Mini kit (74106; Qiagen), and 500ng cDNA was synthesized with random hexamers by reverse transcription (SuperScript III ...
-
bioRxiv - Cancer Biology 2020Quote: ... and collected into a PCR tube containing 7 µL of 2×TCL lysis buffer (Qiagen) with 2% v/v 2-mercaptoethanol (Sigma) ...
-
bioRxiv - Cell Biology 2022Quote: ... with 1% 2-mercaptoethanol then passed through Qiashredder tubes (Qiagen). RNA was extracted using the RNeasy Isolation Kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... loaded with 1-2 ml Ni-NTA agarose resin (Qiagen) pre-equilibrated with binding buffer ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was detected using One-step probe RT-qPCR kits (Qiagen) run on the CFX96 detection system (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was detected using One-step probe RT-qPCR kits (Qiagen) run on the CFX96 detection system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cleared lysate was then incubated with 3 mL of 1:1 Ni-NTA agarose slurry (Qiagen, product number 30210) for 1 hour ...
-
bioRxiv - Immunology 2021Quote: ... homogenized in 1 ml PBS by bead beating (3 mm steel ball, 25 Hz for 1 min in a TissueLyser (Qiagen)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were diluted in TE buffer and treated with 1 μL of 20 mg/mL RNAse A (Applichem) for 1 h and 3 μL of Proteinase K (Qiagen) for 2 h at 40C ...
-
bioRxiv - Cancer Biology 2021Quote: Liver tissue was homogenized in chloroform/methanol (2:1, 1 mL) using TissueLyser (Qiagen Ltd., Manchester, UK). Deionized water (400 uL ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 1 × 109 CFU of bacteria were mixed at a 2:1 (vol:vol) ratio of RNAProtect (Qiagen) and incubated at room temperature for 5 min ...