Labshake search
Citations for Qiagen :
301 - 350 of 1546 citations for 7 Oxabicyclo 4.1.0 heptane 3 carboxylicacid 2 ethylhexyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... the ViiA 7™ Real-Time PCR system was used to run the Human Stem Cell RT² Profiler™ PCR Array (Qiagen, Hilden, Germany). For the analysis of cardiac differentiation-associated genes ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or miR-200b/200c on the ZC3H11A 3’UTR were obtained from Qiagen. TSBs were resuspended in ddH2O to prepare a 50 µM solution ...
-
bioRxiv - Biochemistry 2021Quote: ... The sample was then loaded onto 3 ml of Ni-NTA resin (Qiagen) by gravity at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... n=3) using the RNeasy Mini kit (Cat. No. 74104, QIAGEN, Hilden, German) and manufacturer’s protocol ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...
-
bioRxiv - Microbiology 2020Quote: ... by bead beating (50 Hz for 3 five-minute cycles, TissueLyzer II (Qiagen) with 0.1 mm silica beads) ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated from 3 dpf larvae with the RNeasy mini kit (QIAGEN). A cDNA library was generated from the 3 dpf RNA using the high-capacity cDNA reverse transcription kit (ThermoFisher) ...
-
bioRxiv - Neuroscience 2020Quote: NALCN-siRNA and control-siRNA with modification of 3’-AlexaFluor488 (QIAGEN, Maryland, USA) were dissolved in RNase-free water (NALCN-siRNA ...
-
bioRxiv - Cancer Biology 2020Quote: DNA from ~3×106 cells was extracted with DNeasy Blood&Tissue kit (Qiagen). For SUM159PT/MDA-MB-231 hybrids and MCFDCIS/SUM159PT from lung metastasis CytoSNP-12 v2.1 BeadChip array from Illumina was used and data analyzed with GenomeStudio 2.0 software (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... and 12-days post infection (3 samples/group) using the RNeasy Kit (Qiagen). Samples were processed at the Baylor College of Medicine Genomic and RNA Expression Profiling Core (Houston ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were cleaned of enzymes by adding 3× volume Buffer RLT (Qiagen, 79216) and 1× volume ethanol ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected with pNL4-3 vectors using Attractene Transfection Reagent (QIAGEN, Germany). After 8 hr ...
-
bioRxiv - Microbiology 2020Quote: ... Supernatant was collected on day 3 post transfection and Ni-NTA agarose (Qiagen) was used to purify the protein ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we incubated samples with Qiagen Solution C3 (Qiagen DNeasy PowerSoil 12888-100-3) to remove PCR inhibitors ...
-
bioRxiv - Neuroscience 2022Quote: ... n = 3) from patient and control tissues using the RNeasy mini kit (Qiagen) and diluted to a concentration of 10ng/µL ...
-
bioRxiv - Microbiology 2022Quote: ... in microcentrifuge tubes with 3 mm Tungsten Carbide Beads (Qiagen, St. Louis, MO). Supernatants were clarified by centrifugation and frozen at -80ºC until viral titration ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we incubated samples with Qiagen Solution C3 (Qiagen DNeasy PowerSoil 12888-100-3) to remove PCR inhibitors ...
-
bioRxiv - Microbiology 2023Quote: ... Digested protein was mixed with 3 ml of NTA super-flow resin (Qiagen) that had been pre-equilibrated in wash buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and total RNA was extracted from 3 week-old plants by RNeasy (QIAGEN) or Direct-zol (ZYMO RESEARCH) ...
-
bioRxiv - Biophysics 2023Quote: The library preparation was done using the QIAseq UPX 3’ Transcriptome Kit (QIAGEN). A total of 10ng purified RNA was converted into cDNA NGS libraries ...
-
bioRxiv - Genetics 2022Quote: ... 10 μg dsRNA were transfected into 3×106 Drosophila cells using Effectene (QIAGEN).
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted from Calu-3 cells with RNeasy mini kit (Qiagen). Extracted RNA was quantified and purity was verified by Nanodrop 2000 spectrophotometer (ThermoFisher) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleared and filtered supernatants were applied to 3 mL Ni-NTA Agarose (QIAGEN) equilibrated in buffer B (20 mM HEPES/KOH pH 7.8 ...
-
bioRxiv - Plant Biology 2023Quote: ... Tissue was ground with 3 mm stainless steel beads in a TissueLyser (Qiagen) with intensity of 30 for 1 min ...
-
bioRxiv - Microbiology 2024Quote: ... 3 times for 30 s at 30 Hz using Tissue Lyser II (Qiagen). After centrifugation at 2,000 rpm for 5 min ...
-
bioRxiv - Genetics 2024Quote: ... Insects were homogenized for 3 min at 30 Hz with TissueLyser II (Qiagen), using three 3 mm steel beads (TIS GmbH ...
-
bioRxiv - Genomics 2023Quote: Approximately 3-4 million cells were solubilized with 1 mL QIAzol (Qiagen, 79306) and 0.2 mL chloroform in 5PRIME Phase-Lock Gel heavy tubes (QuantaBio ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... were homogenized in 2-mL tubes containing lysis buffer plus 1% 2-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless-steel beads (Qiagen #69989 ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated from cultures infected with rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 using the QIAamp Viral RNA mini kit (Qiagen) and cDNA synthesis was performed using SuperScript III using hexamers (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from control (n = 2) and olaparib-treated (n = 2) GTFB-PDX1009 ascites using the RNeasy Plus Mini kit (Qiagen). RNA quality was confirmed using an Agilent TapeStation and all RNA used for library preparation had a RIN>9 ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...
-
bioRxiv - Physiology 2023Quote: ... the RNAs from livers (n = 2 mice/group, each group contains RNAs pooled from 2 mice) were prepared (RNeasy, Qiagen). Ribosomal RNA was removed with the Ribozero HMR Gold kit (Illumina).
-
bioRxiv - Genomics 2020Quote: ... cells were mixed 1:2 with RNAProtect (Qiagen) and harvested via centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... Samples were treated with 2 µg RNaseA (Qiagen) and DNA was purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... 2) purifying twice using gDNA-eliminator columns (QIAGEN) before and after DNase treatment followed by RNeasy column purification (QIAGEN) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Mm Aldoa 2 FlexiTube siRNA (Qiagen, SI00896238) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: 2 mL of Ni-NTA resins (Qiagen, USA) were packed into a 5 mL column ...
-
bioRxiv - Immunology 2023Quote: ... 2 ml of Ni-NTA Agarose (Qiagen, 30310) was added per 50 ml of supernatant and the mix was left on a rolling platform at 4°C overnight ...