Labshake search
Citations for Qiagen :
1 - 50 of 3339 citations for 7 Oxabicyclo 4.1.0 heptane 2 carboxylicacid 6 ethyl 1 methyl 5 oxo ethylester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Organs were homogenized by high-speed shaking in 2 mL microcentrifuge tubes filled with sterile PBS and 5/7 mm stainless steel beads using TissueLyser LT (Qiagen, Hilden, Germany).
-
bioRxiv - Immunology 2022Quote: ... corpus (segment 6-7) and cauda (segment 8-10) samples using QIAzol Lysis Reagent (Qiagen) following the manufactureŕs recommendation using a bead-based tissue homogenizer (Retsch ...
-
bioRxiv - Biochemistry 2022Quote: IQN17 was crystallized at room temperature in a hanging-drop vapor diffusion system by mixing 0.3 μL of 15 mg/mL peptide with 0.3 μL of reservoir solution containing 0.1 M imidazole (pH 8.0) and 35 % 2-methyl-2,4-pentanediol (MPD) (Qiagen). Crystals were seen two days after trays were set up ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Immunology 2021Quote: ... Twenty consecutive 10 μm sections were placed on glass slides for subsequent IHC (sections 1-2, 7-8, 13-14, & 19-20) or placed in 600 μl buffer RLT (Qiagen) containing 1% 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: RNA was extracted from root tips (1-2 mm) of 7-d-old seedlings using the RNEasy plant mini kit (QIAGEN), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Epitect Methyl II PCR Array System (Qiagen) was used to determine the CpG island methylation status of CDH1 (E-Cadherin) ...
-
bioRxiv - Neuroscience 2022Quote: EpiTect Methyl II PCR Primer Assay (Qiagen) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: Tocochromanols in 50.3 ± 0.4 mg DW of ground seed powder were extracted in 750 μL of icecold heptane, using two 3-mm diameter glass beads (Carl Roth GmbH+Co, Karlsruhe, Germany) and a Tissue-Lyser (Qiagen, Hilden, Germany) at 25 Hz for 2 min ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... and collected into a PCR tube containing 7 µL of 2×TCL lysis buffer (Qiagen) with 2% v/v 2-mercaptoethanol (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 x 2 minute intervals at 25 Hz with the addition of one 7 mm stainless steel bead (Qiagen #69990). 200 uL of tissue lysate was used for KingFisher Flex (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: Whole genome amplifications were performed on DNA extracts at dilution 10 times through a multiple displacement amplification (MDA) step of 6 to 7 hours using the REPLI-g Midi Kit (QIAGEN) and following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was isolated from liver and lung tissues (n=4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Mini Kit (Qiagen) and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Blood Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Neuroscience 2024Quote: ... and the mouse hippocampal tissues (n=5-6/group; Qiagen, Germantown, MD, USA). The samples of the RNA (500ng/µL ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Plasmids of 5 µg were transfected into 6x10[6] S2 cells using Effectene (Qiagen) and incubated for 3 days ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 5 or 6 Transwells using the RNeasy Micro Plus kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: ... thresholds were used to prepare Reduced Representation Bisulfite Sequencing (RRBS) libraries using the Ovation RRBS Methyl-Seq System 1-16 (NuGen) and the EpiTect Fast DNA Bisulfite kit (Qiagen). Libraries were sequenced using the NextSeq500 platform (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: 2 × 105 cells were reverse-transfected in 6-well plates with Flexitube siRNA constructs (Qiagen) targeting KEAP1 (KEAP1_5 or KEAP1_8) ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng equivalent of pooled total RNA (5 slices per animal; 7 rats) was used to synthesize cDNA using an RT First Strand Kit (Qiagen). Pre-validated primers targeting rat CXCR4 ...
-
bioRxiv - Neuroscience 2020Quote: RNA was extracted from third-instar larval CNS or adult heads (5-7 days post-pupation) with RNeasy Plus Micro kit (Qiagen). RNA isolation was followed with DNase digestion with Turbo DNA-free (Ambion) ...
-
bioRxiv - Cell Biology 2019Quote: ... The reaction was stopped using 15mM EDTA followed by incubation at 65°C for 5-7 min and purification on RNAeasy column (Qiagen). The purified RNA samples were processed for preparations of cDNA libraries using the TruSeq Stranded Total RNA Ribo-Zero H/M/R (Illumina ...
-
bioRxiv - Immunology 2019Quote: ... longitudinal muscle/myenteric plexus preparations were homogenized in a 2 ml eppendorf containing 1 ml Trizol and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Microbiology 2020Quote: ... were homogenized 7 min at 50 pulses s-1 with the Tissuelyser LT (QIAGEN) prior to incubation in lysis buffer for 1 h at 60°C for increasing cell lysis ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated from 5-6 replicated lung slices from each treatment using miRNeasy Mini Kit (Qiagen) at time 0 and time 120 hours for all groups ...
-
bioRxiv - Genetics 2021Quote: Total mRNA was isolated from 2 dpf or 7 dpf zebrafish homogenates using the RNeasy Mini Kit (Qiagen, Cat# 74104) and reverse-transcribed with SuperScript VILO (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µM of forward and reverse oligos were heated for one minute at 100°C with 5 mM MgCl2 and 7 mM Tris-Cl (i.e. Qiagen Elution Buffer) and annealed by slowly cooling to room temperature.
-
bioRxiv - Microbiology 2021Quote: ... 6 (Qiagen) for additional analysis ...
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Plant Biology 2023Quote: ... unexpanded leaves was extracted from 14 individuals (7 early-blooming, 5 late-blooming, and the two parents) with a DNeasy Mini Plant Kit (Qiagen, Hilden, Germany) and quantified with a Quant-iTTM PicoGreenTM dsDNA assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Genomics 2019Quote: ... True Methyl oxBS Module and genomic DNA according to manufacturers’ instructions (Qiagen, NuGen respectively). Bisulfite treated DNA served as templates to PCR-amplify three DNA fragments of 350-400 bp long that cover the entire MLH1 promoter region using ZymoTaq PreMix according to manufacturer’s instructions (Zymo Research) ...
-
bioRxiv - Pathology 2022Quote: ... with stainless steel beads (2×5 mm) using a TissueLyser (Qiagen, Germantown, MD) for three minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... with 2 × 5 mm stainless steel beads using the TissueLyser (Qiagen, Hilden, Germany) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 2–5 min with steel balls in a tissue lyser (Qiagen, Germany). Tissue lysates were incubated with the buffer at 4°C overnight (cell samples were incubated in lysis buffer for 30 min at 4°C) ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNAs were isolated from 6-month H19ΔICR/H19ΔICR and H19+/H19+ littermates (2 per genotype) using RNeasy Plus Mini Kit (Qiagen). Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina) ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).