Labshake search
Citations for Qiagen :
51 - 100 of 1233 citations for 7 Nitro 3 4 dihydro 2H benzo b oxepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: 3 Type D and 3 Type V SCLC tumor-derived cell lines were treated with either vehicle (EtOH) or 4-OHT for 3 days and RNA was isolated using the RNeasy Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Bioengineering 2023Quote: Genome DNA was extracted from each cell line every 3 – 4 days after transfection or transduction using DNeasy Blood and Tissue Kit (QIAGEN) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... All were designed using CLC Genomics Workbench 7 (Qiagen) and synthesized by Eurofins Genomics (http://www.eurofins.com) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 7 µL of PolyFect transfection reagent (QIAGEN, Duesseldorf, Germany) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Physiology 2020Quote: ... RNA was isolated from maternal and fetal tissues (Table 3 and 4) using QIAamp cador pathogen mini kit (Qiagen, Valencia, CA). ZIKV RNA was quantitated by one-step quantitative real time reverse transcription PCR using QuantiTect probe RT-PCR kit (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 150 mg of cluster roots (3 to 4 roots) using the RNeasy Plant Mini Kit (Qiagen, 74904) and treated with the DNA-free DNA Removal Kit (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2019Quote: ... ~2×108 cells/replicate in late exponential and ~4×108 cells/replicate in stationary phase were incubated with RNAprotect Bacteria Reagent (Protocol 3, Qiagen, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from NPCs and their derived astrocytes (4 lines, n=3 per cell type) using a RNeasy mini kit (Qiagen, 74104). RNA samples were prepped using TruSeq® Stranded mRNA Library kit (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was isolated from 16 placentas (3-4 placentas/fetal sex/group) using an RNAeasy kit (Qiagen, Venlo, The Netherlands). Isolated RNA was stored at −80 °C in nuclease-free water ...
-
bioRxiv - Genomics 2020Quote: ... and GeneRead Adapter I set B (Qiagen, cat # 180986) according to Qiagen protocol with one exception ...
-
The G2-phase enriched lncRNA SNHG26 is necessary for proper cell cycle progression and proliferationbioRxiv - Molecular Biology 2021Quote: ... and Negative control B Antisense LNA GapmeR (Qiagen, LG00000001) were used as controls for siRNAs and ASOs ...
-
bioRxiv - Bioengineering 2023Quote: ... 7 and 15 days and purified using RNeasy kit (Qiagen). 1 μg of RNA per condition was used to retrotranscribe into cDNA QuantiTect® Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was isolated from HFC (n = 3) and LFC (n = 4) tumor samples using the RNeasy Plus Universal Mini Kit (QIAGEN, Valencia, CA) and RNA quality was confirmed using an Advanced Analytical Fragment Analyzer ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... striatal and retinal RNA from the same R6/1 mice was pooled (3-4 samples per genotype) and further processed using the clean-up protocol of the RNeasy Mini Kit (Qiagen, Hilden, Germany), which also included on-column DNase I treatment ...
-
bioRxiv - Immunology 2021Quote: B cell subsets were sorted directly into RLT buffer (Qiagen) with 1% mercaptoethanol and then snap-frozen in LN2 ...
-
bioRxiv - Microbiology 2020Quote: ... 1A and B and lysed in RLT buffer (Qiagen, Germany) for RNA isolation ...
-
bioRxiv - Immunology 2022Quote: ... B cell subsets were sorted directly into RLT buffer (Qiagen), and RNA isolated immediately ...
-
bioRxiv - Immunology 2022Quote: ... Antigen specific B cells were gated with CD19+/IgM-/IgD-/Ghost dye-/PE+/BV605+ and sorted in catch buffer B (Qiagen TCL Buffer + 1% beta mercaptoethanol) by one cell per well in a 96 well plate ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was collected 7 days post-TGFB1 treatment (RNAeasy Kit, Qiagen). cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... IDT) in a tube containing 7 μL Vapor-Lock (Qiagen, 981611) to prevent evaporation ...
-
bioRxiv - Genomics 2023Quote: ... The 600 cell pellets (1e+7) were prepared with RNAprotect (Qiagen) and stored at -80°C until shipment on dry ice ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmids were transfected in COS-7 cells with Effectene (Qiagen, Germany) according to the manufacturer’s protocols for 22 hours ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... A2 and B Wolbachia using PyroMark Assay Design 2.0 (Qiagen, USA). A complete list of primers sequences could be found in Table S3 ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted using a Puregene Tissue Core Kit B (Qiagen).
-
bioRxiv - Genetics 2019Quote: ... expand them and extract genomic DNA (Puregene Core Kit B, Qiagen) to improve the quality of the sequencing reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... and RNA was isolated at day 7 using RNeasy Micro Kit (Qiagen). For each experiment untreated vehicle controls were applied ...
-
bioRxiv - Cell Biology 2023Quote: ... snap frozen samples were homogenized in an Eppendorf tube using a 3-mm Tungsten carbide beads and TissueLyser II system (Qiagen; 4 min at 30 Hz). RNA isolation steps were followed as mentioned above in this section ...
-
bioRxiv - Cancer Biology 2023Quote: ... with the addition of 1% B- mercaptoethanol using the TissueLyserII (85300, Qiagen) in combination with 5mm stainless steel beads (69989 ...
-
bioRxiv - Cell Biology 2019Quote: ... KIF4A siRNA 5’-CAGGTCCAGACTACTACTC-3’ against the 3’-UTR was obtained from QIAgen, and an optimised siRNA pool for KIF22 (KID ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3’mRNA-seq libraries were prepared using QIAseq UPX 3’ Transcriptome Kit (QIAGEN). In brief ...
-
bioRxiv - Genetics 2021Quote: ... and 7 healthy controls using the miRNeasy Serum/Plasma Kit (Qiagen, Hilden, Germany) following the manufacturer isolation protocol ...
-
bioRxiv - Systems Biology 2019Quote: ... with custom miRCURY LNA PCR primers (Qiagen cat. no. 339306, Supplementary Table 7). Each 10 µL reaction volume contained 5 µL 2x miRCURY SYBR Green Master Mix ...
-
bioRxiv - Plant Biology 2021Quote: ... extracted in phosphate buffer (pH = 7) and finely ground using Tissuelyzer II (Qiagen) with settings of 30 seconds at 30 Hz ...
-
bioRxiv - Immunology 2020Quote: ... Supernatants were collected 7 days later and bound with Ni-NTA Agarose (Qiagen) in 20mM Sodium Phosphate ...
-
bioRxiv - Cell Biology 2019Quote: siRNAs used were as follows: Kif5b#3 (target sequence 5′-CAGCAAGAAGTAGACCGGATA-3′; Qiagen SI00176050), Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′ ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Genomics 2020Quote: ... and B cells) using the Qiagen AllPrep RNA/DNA kit (Qiagen, CA, USA). 500ng of DNA from each sample was treated with sodium bisulfite ...
-
bioRxiv - Immunology 2019Quote: RNA was extracted from sorted B cells subpopulations using the RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was isolated from mouse B cells using the DNeasy kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... aureus genomic DNA was purified using the Puregene yeast/bacteria kit B (Qiagen). Lysostaphin ...
-
bioRxiv - Immunology 2023Quote: ... Remaining B cells were lysed and mRNA was extracted using TurboCapture plates (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and cryopreserved B cells using the DNeasy Blood & Tissue Kit (Qiagen, cat # 69506). The Carrington Lab (National Cancer Institute ...
-
bioRxiv - Immunology 2023Quote: ... B cell lysis and RNA extraction were performed using the RNeasy Kit (Qiagen), with the quality and concentration measured using Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2019Quote: ... 7 days-old seedlings and flower buds with the RNeasy Plant Mini kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA was collected from 7-12hr embryos per manufacturer’s specification (RNeasy kit, Qiagen), and submitted to Novogene (Sacramento ...