Labshake search
Citations for Qiagen :
201 - 250 of 3688 citations for 7 Methyl 1 5 dioxo 1 2 3 5 tetrahydro indolizine 6 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs used were: AllStars Negative control siRNA (cat# 1027281) and si-Rab13 #8 (cat# SI02662702; target sequence: 5’-ATGGTCTTTCTTGGTATTAAA-3’) from Qiagen.
-
bioRxiv - Microbiology 2020Quote: ... All samples were then passed 3-5 times through a 26G needle prior to RNA isolation using the RNAeasy mini kit from Qiagen. RNA concentrations were estimated by absorbance measurement at 260 and 280 nm ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Pathology 2021Quote: ... DNA was extracted from epidermal tissue (approximately 3 - 5 mm2 per lesion) using a DNAeasy blood and tissue kit (Qiagen). Regressed and CsA group mice were culled at day 133 post-infection ...
-
bioRxiv - Genetics 2021Quote: ... and 99F8 (150 ng pU6-3-99F8-gRNA (DGRC Cat# 1549) and 150 ng pBS-99F8-5’HR-attP>>Act5C::GFP<
3’HR) loci using Effectene Transfection reagent (QIAGEN) as per the manufacturer’s recommendation ... -
bioRxiv - Cell Biology 2021Quote: Formalin-fixed paraffin-embedded tissues were used for in situ hybridization (ISH) employing locked nucleic acid (LNA) probes labelled with digoxigenin (DIG) at both the 5′- and 3’-ends (Qiagen). ISH was performed with probes specific for miR-132-3p (10 nM ...
-
bioRxiv - Developmental Biology 2022Quote: A repair template containing TagRFP-T::AID with homology at the 5’ and 3’ ends to the egl-43 locus was PCR amplified and purified using a PCR purification kit (Qiagen). 3 μl of 10 μM tracRNA (IDT ...
-
bioRxiv - Genomics 2022Quote: ... were annealed (10 μL each 100 μM) to 10 μL 5′-[Phos]-CTGTCTCTTATACACATCT-3’ oligonucleotide (100 μM) within 80 μL EB buffer (Qiagen), incubating 2 min at 95°C and cooled to room temperature (0.1°C/sec) ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-5 mm ear primordia of the inbred line B73 using RNeasy Mini Kit (Qiagen) with on-column DNase I (Qiagen ...
-
bioRxiv - Genomics 2023Quote: ... Second strand synthesis was performed after thawing by the addition of 5 µL of second strand synthesis mix (3 µL of elution buffer [Qiagen] ...
-
bioRxiv - Genomics 2023Quote: ... 1µM Template-Switching Oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” prefixes a ribonucleic acid base and “+” prefixes a locked nucleic acid base, Qiagen) then incubated using a ThermoMixer C with the following conditions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 200 ng psiCHECK-2 reporter plasmid were co-transfected with 5 µl miScript miRNA mimics (Qiagen; CatNo. 219600) using 4 µl Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... incubated at 65°C for 5 min and beaten for 5 min in a bead beater (Qiagen) set at high speed ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were then harvested by centrifugation (5 min, 10,000 × g) and immediately suspended in 1 mL bacterial RNA protect (Qiagen, Germantown, MD), followed by 5 min incubation at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... The 319 bp DNA size of PCR products were clarified by 1% agarose gel electrophoresis using 5 μL PCR products and remained DNA were purified by QIAquick PCR Purification Kit (Qiagen, 28104). The purified PCR products were sequenced by Sanger Sequencing approach (GeneWiz ...
-
bioRxiv - Genetics 2020Quote: ... suspended in 1 mL of (v/v) 50% ACN and homogenized in a bead mill (50 Hz, 5 min; TissueLyser LT, Qiagen, Germany) using two 5 mm tungsten balls ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we homogenized 2-3 fecal pellets in 1 mL H2O using ceramic beads (NucleoSpin, Macherey–Nagel, Dueren, Germany) and a TissueLyser (Qiagen, Hilden, Germany), mixing the sample for 3 × 30 s at 4,500 rpm with a 10 s cooling break (< 0°C) ...
-
bioRxiv - Genomics 2020Quote: ... cells were mixed 1:2 with RNAProtect (Qiagen) and harvested via centrifugation ...
-
bioRxiv - Cell Biology 2019Quote: ... 3-5 million cells were then harvested and genomic DNA was isolated using QIAamp DNA mini kit (QIAGEN, prod. number 51304). The following L1 recovery steps were adapted from24,52 with modifications ...
-
bioRxiv - Microbiology 2022Quote: ... and the amplified DNA bands from the 5’ and 3’ ends were individually excised and purified with QIAquick® Gel Extraction Kit (QIAGEN). Purified PCR products were cloned into pJET1.2/blunt plasmid (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Cells were maintained at 37°C in 5% CO2 for 3 days before collecting genomic DNA using DNeasy Blood & Tissue Kits (Qiagen, 69504) and sequencing.
-
bioRxiv - Cancer Biology 2020Quote: ... Epitect Methyl II PCR Array System (Qiagen) was used to determine the CpG island methylation status of CDH1 (E-Cadherin) ...
-
bioRxiv - Neuroscience 2022Quote: EpiTect Methyl II PCR Primer Assay (Qiagen) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Molecular Biology 2022Quote: Two independent siRNAs targeting YBX1 (Hs_YBX1-1 and Hs_YBX1-6 FlexiTube siRNA, Qiagen) and a non-targeting negative control siRNA (AllStars ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were homogenized in 1 ml cell culture medium (see above) and a 5 mm steel bead in a TissueLyser (Qiagen, Hilden, Germany). Fecal samples were vortexed in sterile NaCl and the supernatant was sterile filtered (22µm ...
-
bioRxiv - Immunology 2020Quote: YFP+ Treg cells were sorted from spleen and LN of WT or Usp22fl/flFoxp3YFP-Cre mice (n=5 per group) and total RNA was isolated from 1×106 cells per sample using an RNeasy Mini Kit (Qiagen, Cat# 74104) as previously described47 ...
-
bioRxiv - Genetics 2020Quote: ... 30 mg of snap frozen tissues were processed adding 1 ml of QIAzol reagent in presence of one 5 mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and isolated keratinocytes and fibroblasts from the skin and Wound7 (n = 5/each group) (Table 1 and Table S1) by using the miRNeasy Mini kit (Qiagen, Hilden, Germany) and prepared for library construction ...
-
bioRxiv - Cancer Biology 2023Quote: ... we adapted the same conditions used in Dip-C40 and lysed each nucleus in 150 nL of lysis buffer containing 20 mM Tris pH8/20 mM NaCl/25 mM DTT/0.15% Triton X-100/1 mM EDTA/5 µg/mL Qiagen Protease (Qiagen, cat. no. 19157). After dispensing ...
-
bioRxiv - Immunology 2024Quote: Genomic DNA was then isolated from 1-5 million isolated PBMCs using the DNeasy Blood and Tissue kit (Qiagen; Cat. No. 69504) following manufacturer instructions ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...
-
bioRxiv - Bioengineering 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 μL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Stainless steel 5 mm beads (Qiagen, Germany) were additionally sterilised by heating at 220°C for 3 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5 mm stainless steel beads (Qiagen) at 30 Hz for 3 min at 4°C ...