Labshake search
Citations for Qiagen :
251 - 300 of 1365 citations for 7 METHOXY 1H QUINOLIN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: RNA was extracted from third-instar larval CNS or adult heads (5-7 days post-pupation) with RNeasy Plus Micro kit (Qiagen). RNA isolation was followed with DNase digestion with Turbo DNA-free (Ambion) ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA from plants grown for 7 days after germination in rhizoboxes was extracted with the RNeasy Plant Mini Kit (Qiagen) and first strand cDNA was synthesised with the RevertAid First Strand cDNA synthesis Kit (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... Quality control and de novo assembly of the reads were done using default parameters in CLC Genomics workbench 7 (Qiagen). Whole-genome alignment was performed using Mugsy v1.2.3 (55 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was isolated from liver and lung tissues (n=4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Mini Kit (Qiagen) and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Blood Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The reaction was stopped using 15mM EDTA followed by incubation at 65°C for 5-7 min and purification on RNAeasy column (Qiagen). The purified RNA samples were processed for preparations of cDNA libraries using the TruSeq Stranded Total RNA Ribo-Zero H/M/R (Illumina ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was extracted from 1×10^7 PBMCs using the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen, Hilden, Germany). Following nucleic acid isolation ...
-
bioRxiv - Immunology 2021Quote: ... single MR1-tetramer-binding cells from Peruvian participant 7-3 and blood bank donors 702A and 703A were sorted into 96-well plate coated with Vapor-Lock (Qiagen) containing Iscript cDNA synthesis mixture (Bio-Rad ...
-
bioRxiv - Developmental Biology 2019Quote: ... Cells with ESC like morphology were picked and 7 clones successfully expanded for genomic DNA isolation using DNeasy Blood and Tissue Kit (Qiagen) followed by genotyping using Taq DNA polymerase (Takara ...
-
bioRxiv - Plant Biology 2021Quote: DNA for bisulfite sequencing was isolated from dissected endosperm at 7 days after pollination using QiaAMP DNA microkit (QIAGEN 56304). Dissected tissue was obtained for two biological replicates for each genotype and incubated overnight in a shaker at 56°C in ATL buffer with Proteinase K ...
-
bioRxiv - Cell Biology 2021Quote: ... These M-cells were resuspended in 500 μl PBS pH 7.2 and mixed with 7 μl BioMag magnetic streptavidin beads (Qiagen, 311714) for 60 min at 4°C and loaded into an acrylic column with curved grade N52 magnet ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from freshly isolated T-cells on day 7 of treatment from spleens using RNeasy Kit (Qiagen). For each group ...
-
bioRxiv - Pathology 2023Quote: ... Skeletal muscle (triceps and Tibialis anterior (TA)) and spinal cord tissue samples underwent homogenization with 7 mm stainless steel beads (#69990, Qiagen) in a Tissue Lyser LT (#85600 ...
-
bioRxiv - Neuroscience 2023Quote: RNA was isolated from mature wildtype DA neurons following 7-day treatment with GluCer using the RNeasy Micro Kit (QIAGEN) and sent for bulk RNAseq to Azenta ...
-
bioRxiv - Immunology 2024Quote: TET2 knockout efficiency was confirmed by isolating genomic DNA from CAR T-cells at Day 7 using the dNeasy Blood & Tissue Kit (Qiagen). PCR of genomic DNA was performed with TET2 Forward Primer 5’-TCCCTGAGTCCCAGTCCATC-3’ and Reverse Primer 5’-TCAGGAATGGCCAGGTTCTG-3’ using MyTaq Red 2X Mix (Meridian Bioscience) ...
-
bioRxiv - Immunology 2023Quote: ... The resulting cell suspension was concentrated by centrifugation (7 min, 350 g) and lysed in RLT buffer(Qiagen, cat. 79216) 0.1-0.5 *10^6 lymphocytes /sample density ...
-
bioRxiv - Plant Biology 2024Quote: ... about 20 mg of tissue from 7-day-old seedlings was ground into fine powder in liquid nitrogen with a TissueLyser system (QIAGEN). Total proteins were extracted using denaturing buffer (100 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA from 7 of these patients was extracted from CD138+ cells using the miRNeasy Mini Kit (Qiagen GmbH, Germany) according to the manufacturer’s instruction ...
-
bioRxiv - Biophysics 2024Quote: ... where the band corresponding to the desired handle length (∼1.6 kb or 1.7 kb for LH and RH respectively) was excised and then the DNA extracted using a gel-extraction kit (Qiagen). The RNA hairpin substrate was then annealed and ligated between the LH and RH handles (see final construct configuration as in Fig ...
-
bioRxiv - Genomics 2022Quote: ... After overnight proteinase K digestion in Lysis Buffer (Bionano Genomics) and one hour treatment with RNAse A (Qiagen), plugs were washed four times in 1x Wash Buffer (Bionano Genomics ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA was extracted from overnight cultures issued from one isolated colony following standard protocols (QIAGEN DNAeasy, Hilden, Germany). As controls ...
-
bioRxiv - Cell Biology 2021Quote: One µg of total RNA extracted from ELT3-V cells with the RNeasy Mini Kit (Qiagen, Germantown, MD) was reverse-transcribed into cDNA using amfiRivert cDNA Synthesis Master Mix (GenDEPOT ...
-
bioRxiv - Plant Biology 2021Quote: ... Sets of 95 ligations were pooled into one sample and purified using QIAquick PCR Purification Kit (Qiagen, Germany). The pooled ligation mixtures (5 μL ...
-
bioRxiv - Microbiology 2022Quote: ... the bacterial assemblage genomic DNA was extracted from one g of beads using DNeasy PowerSoil Pro kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... complementary DNA strand was synthesized from one μg of total RNA using QuantiTect® reverse transcription kit (Qiagen). Quantitative RT-PCR gene amplification was carried out using the CFX-96 thermocycler (Bio-Rad ...
-
bioRxiv - Pathology 2019Quote: ... RNA was extracted from PRRSV and one replicate of CDV using the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The quantitative real-time TaqMan based assay was carried out using a One-step RT-PCR kit (Qiagen) in the Light Cycler 2.0 system (Roche) ...
-
bioRxiv - Genetics 2021Quote: Long PCR products were purified by gel electrophoresis and short ones with the QIAquick PCR purification kit (Qiagen). Terminal adenine overhangs were added using Taq polymerase in the presence of dATP ...
-
bioRxiv - Genetics 2020Quote: ... reverse primers 852Rb-AGGAAGATAGAGAAAGAGCAACC and 852Rc-AGGAAGATAGAAAAGGAGCAACC using QIAGEN One-Step RT-PCR kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 5μL of the resulting DNA underwent one or more displacement amplifications using the Repli-G MDA kit (Qiagen), to enrich microbial DNA ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... One microgram of genomic DNA was bisulfite converted with the EpiTect® Fast 96 DNA Bisulfite Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA extraction was carried out using one of the following methods: 1) QIAmp DNA Mini Kit (Qiagen, Germany); 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... One hour of tagmentation at 37°C was followed by DNA extraction using MinElute PCR Purification Kit (Qiagen). Extracted DNA was subjected to PCR amplification using unique primers sets (Nextera XT v2 Full set (N7-S5)) ...
-
bioRxiv - Genetics 2021Quote: Total RNA samples from kidneys and livers harvested from 7-week-old normal and cyli mice were prepared using RNeasy Mini kit (Qiagen, # 74104), treated with RQ1 RNase-Free DNase (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from 32D-Cas9 cell lines expressing sgRNAs targeting Cbl introns 7 and 8 using an RNeasy Mini Kit (QIAGEN, 74106). cDNA was prepared using a QuantiTect Reverse Transcription Kit (QIAGEN ...
-
bioRxiv - Bioengineering 2022Quote: RNA was isolated from hBSMC microtissues that were either untreated or treated with TGF-β1 and IL-13 for 7 days prior to RNA isolation using the RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Plant Biology 2022Quote: Two RNA samples from rosette leaves of after-bolting WT plants and bglu28/30-2 mutant plant grown under different S conditions and their 7-day-post-anthesis siliques were extracted with the RNeasy Plant Mini Kit (QIAGEN, Germany). The residual DNA was removed with DNase treatment (DNaseI ...
-
bioRxiv - Neuroscience 2022Quote: ... 30µL of DNase and RDD buffer (1:7 ratio) containing solution from the RNase-Free DNase Set (Qiagen, Catalog No. 79254) was incubated on the columns at room temperature for 15 minutes before a second and third round of RNA was performed as well as a final spin to ensure the column was dry ...
-
bioRxiv - Systems Biology 2023Quote: ... The insoluble fraction was solubilized in 7 M urea At-buffer and purified on a Ni-NTA mini-column (Qiagen Inc.) with At-buffer (100 mM Tris-HCl buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was extracted from the leaves harvested at 7 days after pathogen inoculation using a DNeasy Plant Mini Kit (Qiagen, Germany). Subsequently ...
-
HOIL-1L deficiency induces cell cycle alteration which causes immaturity of myocyte and fibrogenesisbioRxiv - Cell Biology 2023Quote: Total RNA was extracted from day 0 to day 7 of myotube differentiation using an RNeasy Mini Kit (Qiagen, Cat.# 74104) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 20 µl RT-PCRs were performed as per the manufacturer’s instructions using the Qiagen One-Step RT-PCR kit (210210, Qiagen) and the following primers ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We extracted DNA from one female (ZW) butterfly per population using Qiagen’s MagAttract HMW DNA extraction kit (Qiagen, inc.) following the manufacture’s suggested protocol ...
-
bioRxiv - Genomics 2020Quote: ... The total RNA solution from 12 wells are passed through one column of RNeasy mini kit (cat.74104, QIAGEN) to obtain approximately 100 g of purified total RNA ...
-
bioRxiv - Genomics 2020Quote: ... Total RNA from Arabidopsis plants was extracted from one month old rosette leaves using RNeasy plant mini kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription-PCR (RT-PCR) was carried out with total RNA using the one-step RT-PCR kit (QIAGEN) according to the supplier’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Cell lysates were then incubated at 4 °C for 1-1.5 hours on one ml of Ni-NTA resin (Qiagen). The resin was then loaded into columns (Biorad ...
-
bioRxiv - Microbiology 2022Quote: ... and microbial Eukaryotic abundance with a QIAcuity One 5-plex digital PCR (dPCR) instrument (Qiagen Inc. USA, Germantown, MD). dPCR samples represented both the 416 Fire —across SBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Real time one step qRT-PCR was carried out using the QuantiTect SYBR® Green RT-PCR Kit (Qiagen) according to manufacturer’s instructions before analysis on the 7900 PCR machine (Applied Biosystems) ...