Labshake search
Citations for Qiagen :
551 - 600 of 3606 citations for 7 Chloro 3 4 2 hydroxyethyl 1 piperazinyl 1 2 propoxyethyl pyrido 3 4 b pyrazin 2 1H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: The supernatant was mixed with 2 mL Ni-NTA resin (Ni-NTA agarose; Qiagen) pre-equilibrated with buffer A200 (50 mM Tris pH 7.6 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were lysed with 27G1/2 needles and then homogenized with QiAshredder columns (Qiagen). Total RNA from triplicate experiments were purified with the RNAeasy Plus Kit (Qiagen) ...
-
bioRxiv - Systems Biology 2020Quote: ... mechanically homogenized and further lysed in RLT buffer with 2-mercaptoethanol on TissueLyser (Qiagen) with 3 mm beads then extracted according to the protocol using RNeasy Mini Kit (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... The cleared lysate was run through Ni+2-NTA agarose beads (Qiagen [QA], 30250) to allow binding of the histidine-tagged (recombinant ...
-
bioRxiv - Cell Biology 2021Quote: ... before adding it to 2 ml of Strep-Tactin superflow resin (Qiagen, Hilden, Germany) which was pre-equilibrated with 10 ml lysis buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... and homogenized for 2 cycles with a Bead Beater TissueLyser II (Qiagen, Germantown, MD) at 24 Hz for 3 min each ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM 2-mercaptoethanol) and the proteins eluted from nickel-NTA agarose beads (Qiagen; using buffer containing 25 mM Tris-HCl (pH 7.6) ...
-
bioRxiv - Microbiology 2022Quote: RNA was isolated from 2 x 106 cells using RNeasy plus mini Kit (Qiagen). Reverse transcription was performed with either random decamers or HIV antisense-specific primers ...
-
bioRxiv - Microbiology 2020Quote: ... Lung samples were homogenized with DMEM + 2% FBS in a TissueLyser (Qiagen Inc., CA) operated at 25-30 Hz for four minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cell lysate supernatant was passed through a Ni+2-NTA resin column (Qiagen), and protein was purified following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... 20 mg ground freeze-dried tissue (TissueLyserII Qiagen, Hilden, Germany; 2×45sec, 30 Hz) was used for DNA extraction (DNeasy Plant Mini Kit ...
-
bioRxiv - Cell Biology 2019Quote: ... Rosa26mT/mG 2 weeks after tamoxifen treatment using a miRNeasy Micro Kit (Qiagen, 217084). Library preparation and sequencing were performed by Cedars-Sinai Genomic Core using Illumina NextSeq 500 (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Feces samples were homogenized for 2 min at 25 Hz in a TissueLyzerII (Qiagen) using metal beads ...
-
bioRxiv - Cell Biology 2020Quote: ... CLEC-2-expressing or PDPN KO FRCs were transfected using Attractene Transfection Reagent (Qiagen) with one or both of the following plasmids ...
-
bioRxiv - Immunology 2021Quote: ... The product was run on a 2% gel and purified by gel extraction (Qiagen). Purified product was amplified using primers index3 and index6 ...
-
bioRxiv - Immunology 2021Quote: ... The product was run on a 2% gel and purified by gel extraction (Qiagen). Purified product was amplified using primers index3 and index4 ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were run on 2% agarose gels and purified by gel extraction (Qiagen). Purified barcode and gene products were combined with linearized yeast-display vector (pDD003 digested with EcoRI and BamHI ...
-
bioRxiv - Genetics 2020Quote: ... 2 µL of bisulfite-converted DNA were amplified with the HotStartTaq DNA Polymerase (QIAGEN) and primers containing internal barcodes using following conditions ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 3.2 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 30 r/s for 3 cycles ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... collected in DMEM with 2% serum and homogenized using a Tissue-Lyser II (QIAGEN). Samples were centrifuged at 8,000 rpm for 8 minutes and viral titers were quantified using a plaque assay as described above ...
-
bioRxiv - Developmental Biology 2023Quote: 2 μg of genomic DNA was bisulfite treated using the EpiTect Bisulfite Kit (Qiagen) and eluted in 20 μL of 1:10 of the supplied EB buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... Homogenization was performed with 2 tungsten beads using a Tissue Lyser (Qiagen, cat# 85300) run at 30 cycles/sec ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Plant Biology 2021Quote: ... The translation mixture was gently agitated in a microtube for 1 h at 4°C with a fivefold volume of Ni-NTA agarose (Qiagen) that had been equilibrated with a solution containing 50 mM Tris-HCl (pH 7.5 ...
-
bioRxiv - Genetics 2022Quote: ... The tissue powder was then transferred to a 1.5 mL centrifuge tube where 400 μL of 1% PVP-40 Buffer AP1 solution and 4 μL of RNase A were added (Qiagen DNeasy Plant Kit Qiagen Inc ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tumors were homogenized with QIAGEN Tissue Lyser (4 × 1’, 30 Hz) using a 5mm stainless steel bead (Qiagen, Hombrechtikon, Switzerland) and sonicated for 20s ...
-
bioRxiv - Plant Biology 2020Quote: ... After vortexing the samples for 10 s and lysing the tissue with 4 mm glass beads for 1 min at 30 Hz in the TissueLyser II (Qiagen), 400 μL of Tris-HCl pH:7.5 were added and the samples were again mixed for 1 min in the TissueLyser ...
-
bioRxiv - Immunology 2020Quote: RNA was extracted from isolated neutrophils after the 1 and 4 hour EC challenges as well untreated controls using the miRNeasy Micro kit from Qiagen and libraries were generated using KAPA PolyA enrichment mRNA library prep ...
-
bioRxiv - Genomics 2021Quote: ... To eliminate lipids supernatants were applied to a RNeasy column and centrifuged at 10,000 rpm and 4 °C for 1 min (Qiagen, 74104). The flow through was collected and protein concentrations were assessed using the Bradford assay ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.4 mg/mL Proteinase K (55°C for 1 hour) before being purified using the QIAquick PCR purification kit (QIAGEN). qPCR was performed on the Rotor-Gene 3000 (Corbett Life Science ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting mixture was rotated at 4 °C for 60 min and then poured into a 1 mL polypropylene column (Qiagen). The resin was washed three times with 5 mL lysis/wash buffer and eluted in 0.25 mL fractions with Ni-NTA elution buffer (composition same as lysis/wash buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... previously coated with the anti-B55δ antibody (1 hour incubation at 4°C, followed by extensive washes) and Nickel beads (Qiagen) coated with 400 μg of 6XHIS-S67thio-S109A-XeARPP19 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...