Labshake search
Citations for Qiagen :
201 - 250 of 2098 citations for 7 Chloro 1H pyrrolo 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and 7 were isolated using a Plant RNeasy Mini kit with DNase I treatment (Qiagen, Hilden, Germany). Three biological replicates were prepared for each tissue type ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA from the MC.7.G5 clone was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and from blood by using either DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 min, 4°C) prior to incubation (1 h, 4°C) with 4.0 mL of Ni-NTA agarose (Qiagen) pre-equilibrated in the same buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was extracted from plant cells and Hi-C libraries were prepared using EpiTect Hi-C Kit (Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from the gut samples (7-10 guts/sample) using the RNeasy Mini kit (Qiagen) and the on-column DNase I treatment (79254 ...
-
bioRxiv - Biochemistry 2021Quote: ... supernatant was harvested after 7 days of expression and incubated with 300 μL of Ni-NTA resin (Qiagen) at 4°C overnight ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was extracted from seedlings 7 dpg using the RNeasy Plant RNA Extraction kit (Qiagen Ltd., Surrey, UK). RT-PCR was performed using the OneStep RT-PCR kit (Qiagen ...
-
bioRxiv - Bioengineering 2022Quote: Tissue samples at day 0 and 7 were collected from devices and dissociated in the lysis buffer (Qiagen) by agitating with an electronic pestle for 1 min ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from MCF-7 cells (1×106 cells/well) was isolated using RNeasy Mini kit (74106; Qiagen), and 500ng cDNA was synthesized with random hexamers by reverse transcription (SuperScript III ...
-
bioRxiv - Molecular Biology 2019Quote: ... 120 µL of elution buffer of elution buffer II (10 mM Tris pH 8.0, 1 mM EDTA, 0.67% SDS) and 7 µL Proteinase K (Qiagen) was added ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... Transfection into C2C12 or MCF-7 cells utilized a lipid-based reagent (Fast-forward protocol, Effectene reagent, Qiagen). As a reference for transfection efficiency ...
-
bioRxiv - Plant Biology 2023Quote: ... The grinding was done using 7 mm stainless steel beads with TissueLyser II bead mill (Qiagen, Hilden, Germany), 2 minutes totally at 25 Hz ...
-
bioRxiv - Immunology 2023Quote: ... cytometry-sorted 7-AAD- CD45+CD11b+F4/80+ cells were lysed in 350µL RLT lysis buffer (Qiagen, 79216). At 4 days post injury ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pH 5.8) under long day condtions (16h light) at 24 °C (day) 22 °C (night) using the DNeasy Plant Kit (Qiagen). ONSEN copy numbers were determined by qPCR using 12 ng total DNA using the KAPA SYBR FAST master mix universal on a C1000 Touch (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... were frozen at −80°C and subsequently digested at 56°C overnight by Proteinase K (10mM in Tris-HCl, 19133, Qiagen). To account for potentially differential cell proliferation rate between treatments all the ATP quantifications were normalized to DNA content in the same samples ...
-
bioRxiv - Genomics 2023Quote: ... The bead-bound gDNA was isothermally amplified for 3 hours at 30 °C then 10 minutes at 65 °C using a miniaturised (1/5 vols) Repli-g Single-Cell assay (Qiagen). The amplified gDNA was cleaned up with 0.8 × vols Ampure XP and 80 % ethanol ...
-
bioRxiv - Microbiology 2023Quote: ... Eluates were then treated with Proteinase K (45°C, 1400rpm, 4h) and RNaseA (37°C, 1400rpm, 30min) before cleanup using MiniElute PCR Purification kit (Qiagen). Purified DNA together with input samples before immunoprecipitation were amplified using qPCR SyBr green mix (PCR Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time PCR assays were carried out in triplicate to amplify the Wolbachia wsp gene [43] and host reference gene GAPDH (378 F_ 5’-CCGGTGGAGGCAGGAATGATGT-3’, 445 R_5’-CCACCCAAAAGACCGTTGACG-3’) on a Rotor-gene Q Instrument (Qiagen, NSW, Australia). Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Genomics 2019Quote: ... and stored at −20°C until midiprepped (Qiagen) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... 4°C) and stored at −80°C before metagenomic extraction using the DNeasy PowerSoil kit following manufacturer specifications (QIAGEN, Hilden, Germany). All sampling and sample processing was conducted following cold chain principles ...
-
bioRxiv - Synthetic Biology 2024Quote: ... of Gibson Assembly reaction mix was added to NEB Stbl cell (C3040) for transformation and grown at 30°C or 37°C for the plasmid DNA preparation (Qiagen miniprep). The resulting plasmids were sequence-verified using Sanger sequencing (Genewiz).
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...