Labshake search
Citations for Qiagen :
51 - 100 of 769 citations for 7 CHLORO 4 HYDROXY 8 METHYLQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and lysate was passed over 8 mL Ni-NTA resin (Qiagen) using gravity chromatography ...
-
bioRxiv - Immunology 2023Quote: ... and disrupted for 8 minutes in 300 μL ATL buffer (Qiagen) using a Qiagen Tissuelyser at 50Hz with a ceramic bead (MPBio) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 8 wells of cell death control (Qiagen AllStars Positive Control siRNA), and 8 wells of YAP targeting siRNA (Ambion Silencer Select ...
-
bioRxiv - Microbiology 2024Quote: ... Supernatant was passed over 8 ml of Ni-NTA resin (Qiagen), and the resin was washed with 70 ml of lysis buffer supplemented to 1 M NaCl followed by 20 ml lysis buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... 7 days-old seedlings and flower buds with the RNeasy Plant Mini kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA was collected from 7-12hr embryos per manufacturer’s specification (RNeasy kit, Qiagen), and submitted to Novogene (Sacramento ...
-
bioRxiv - Bioengineering 2019Quote: ... Cells were harvested after 3 or 7 days post-transfection (RNEasy mini kit, Qiagen), whereby cDNA was made and amplified via qPCR with primers for GAPDH ...
-
bioRxiv - Immunology 2019Quote: ... Multi-species alignment and cladrograms were constructed using CLC Main Workbench 7 (CLCbio, Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... a total cold volume of 7 μl containing 300 ng random hexamers (Qiagen Operon), 12 U RNasin (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... were homogenized 7 min at 50 pulses s-1 with the Tissuelyser LT (QIAGEN) prior to incubation in lysis buffer for 1 h at 60°C for increasing cell lysis ...
-
bioRxiv - Immunology 2024Quote: ... a cold volume of 7 µL containing 300 ng of random hexamers (Qiagen Operon), 12 U Rnasin (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 h post-infection) using the QIAamp DNA micro kit (QIAGEN). As a parallel control ...
-
bioRxiv - Neuroscience 2023Quote: ... gcy-8 mRNA was detected using a OneStep RT-PCR kit (QIAGEN) from 3 ng of template RNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted from 7 days old protonema using DNeasy Plant Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA was isolated from 7 days old protonemata with RNeasy Plant Mini Kit (Qiagen), treated with DNaseI (DNA-free™ DNA Removal Kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA isolation from 7 PDXs was performed with the Qiagen RNA Kit (Qiagen, Hilden, Germany). Sample quality was assessed using Agilent RNA 6000 Nano Reagent on Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... and collected into a PCR tube containing 7 µL of 2×TCL lysis buffer (Qiagen) with 2% v/v 2-mercaptoethanol (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... The 488 SRAs were assembled using skesa (74) or the CLC Genomics Workbench 7 (QIAGEN) using default parameters ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was isolated from 7-days-old protonemata with RNeasy Plant Mini Kit (Qiagen), treated with DNaseI (DNA-free™ DNA Removal Kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... reads from the two fastq files were paired using CLC Genomics Workbench 7 (Qiagen, Germany). Paired and unpaired data were uploaded and analysed on the public server at usegalaxy.org (48) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tissues were weighed and homogenized in 4 volumes of water (4 µL of water/mg tissue, 4°C) using a bead beater (TissueLyser II, QIAGEN; Germantown, MD). Aqueous homogenates were profiled using four complimentary liquid chromatography tandem mass spectrometry (LC-MS ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5mM EDTA (pH 8) together with a 5 mm stainless steel bead (Qiagen) and macerated at 1,200 rpm for 2 mins in the Geno/grinder followed by a 10-minute centrifugation (17,000 x g ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... After 8 h we isolated total RNA using a RNeasy Plus minikit (Qiagen). 384 TruSeq Stranded mRNA libraries were prepared in 96 sample batches ...
-
bioRxiv - Developmental Biology 2020Quote: ... HF n=8) using the Qiagen RNeasy Plus Mini Kit (Qiagen, Toronto ON). RNA was quantified by spectrophotometry (DeNovix ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 8) and 30 μl of 20 mg/ml Proteinase K (QIAGEN 19131) were added to the tissue/cell sample and incubated at 55°C overnight ...
-
bioRxiv - Bioengineering 2022Quote: ... cDNA was pooled and 8 ng was combined with SYBR Green Mastermix (Qiagen) for aliquoting into a 384-well RT2 Profiler PCR Array with genes from the Mouse Inflammatory Response and Autoimmunity set (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from 7 day-old seedlings with the RNeasy Plant Mini Kit (Qiagen). 300 mg of total RNA were reverse transcribed with ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted from 7-day-old seedlings using RNeasy® Plant Mini-Kit (QIAGEN) and treated with RNase-Free DNase (QIAGEN) ...
-
bioRxiv - Cell Biology 2022Quote: COS-7 cells were transfected with the respective Myc-Sun4-pEGFP fusion constructs using EffecteneTM (Qiagen) following the manufacturer’s protocol and incubated overnight before analysis of the ectopically expressed fusion proteins.
-
bioRxiv - Immunology 2020Quote: ... skin was homogenized in TRIzol using two 7 mm metal beads and a TissueLyser LT (Qiagen). Homogenates were centrifuged to separate an RNA containing aqueous phase ...
-
bioRxiv - Genetics 2020Quote: DNA from 7-day old leaves was extracted for all genotypes using the QIAamp kit (Qiagen) on the QIAcube HT (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... DNA from ~7×106 cells was extracted using a Blood & Cell Culture DNA Midi Kit (QIAGEN) and amplified to examine the coverage of mutant cell libraries ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 7-day-old roots using the RNeasy Plant Mini Kit (Qiagen) and QIAcube (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Plant Biology 2019Quote: ... Sequence files were processed in CLC Genomics Workbench version 8 (Qiagen Bioinformatics, Hilden, Germany); paired Illumina read files and 454 sequencing files were indicated during import ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was isolated from >8 bacterial colonies using QIAprep® Spin Miniprep Kit (Qiagen) and TRIM1 knockout confirmed by sequencing using a T3 forward promoter to confirm truncating stop codons in all copies of the TRIM1 gene present in the genome of selected clones ...
-
bioRxiv - Microbiology 2020Quote: ... Sequences were aligned to the reference viral genome using CLC Sequence Viewer 8 (Qiagen).
-
bioRxiv - Microbiology 2023Quote: RNA was extract from 8 x 106 cells using the RNeasy Mini Kit (Qiagen) protocol ...
-
bioRxiv - Cell Biology 2020Quote: Adrenal glands were homogenized in ammonium-bicarbonate buffer (150 mM ammonium bicarbonate, pH 7) with TissueLyser (Qiagen). Protein content was assessed using BCA Protein Assay Kit (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2021Quote: DNA was extracted from 0.5-7 mg biomass using DNeasy Powersoil microbial extraction kit (Qiagen, Hilden, Germany) accordingly to manufacturer’s instructions and stored at -20°C ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA was isolated from roots of 7-day-old seedlings using RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and 7 were isolated using a Plant RNeasy Mini kit with DNase I treatment (Qiagen, Hilden, Germany). Three biological replicates were prepared for each tissue type ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA from the MC.7.G5 clone was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and from blood by using either DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...