Labshake search
Citations for Qiagen :
451 - 500 of 1411 citations for 7 Bromo benzooxazole 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Hybridization was performed at 66 °C overnight with 40 nM 5′ TYE-563-labelled locked nucleic acid (LNA)-(C4G2)2.5 probe (Exiqon Qiagen). Cells were then washed once in 2X SSC/0.1% Tween-20 for 5 minutes and three times in 0.1X SSC for 10 minutes at RT before being dehydrated as above and nuclei stained with DAPI.
-
bioRxiv - Genomics 2020Quote: ... cells were mixed 1:2 with RNAProtect (Qiagen) and harvested via centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... Samples were treated with 2 µg RNaseA (Qiagen) and DNA was purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... 2) purifying twice using gDNA-eliminator columns (QIAGEN) before and after DNase treatment followed by RNeasy column purification (QIAGEN) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Mm Aldoa 2 FlexiTube siRNA (Qiagen, SI00896238) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: 2 mL of Ni-NTA resins (Qiagen, USA) were packed into a 5 mL column ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Immunology 2023Quote: ... 2 ml of Ni-NTA Agarose (Qiagen, 30310) was added per 50 ml of supernatant and the mix was left on a rolling platform at 4°C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... with Negative Control GapmeR A (30300019-2, Qiagen) using 3.5 μl of Lipofectamine 2000 in Opti-MEM I reduced serum medium following the manufacturer’s suggested protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2) DNeasy Blood and Tissue Kit (Qiagen, Germany); 3 ...
-
bioRxiv - Immunology 2024Quote: 2 ml MaXtract High Density tubes (Qiagen, 129056) were centrifugated at 12,000–16,000 × g for 20-30 second centrifugation ...
-
bioRxiv - Immunology 2019Quote: ... approximately 25 mg of tissues were homogenized in 2 mL tubes containing 600 μL of Buffer RLT with 2% β-mercaptoethanol and a stainless steel bead (5 mm, Qiagen) using a TissueLyser II system (Qiagen) ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA from Arabidopsis seedlings (Col-0, sphk1-2, SPHK1-KD and gcs-2) were extracted using RNeasy® Plant Mini Kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... upwards was isolated from two different clones of pBABE-SAOS 2 and hTERT-SAOS 2 stable cell lines by using miRNeasy Mini Kit (Qiagen, #79306), following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by RNA extraction with TRIzol using Tissue Lyser II (30 Hz frequency for 2 min with 2 cycles, Qiagen, Germany). Equal amounts of RNA from each sample were reverse transcribed in 20 μl to produce cDNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using the QIAseq SARS-CoV-2 Primer Panel V2 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using QIAseq SARS-CoV-2 Primer Panel V1 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Germany) using a metal ball for 2×2 min at 25 s−1 in 600 μl of RLT buffer (Qiagen, Germany) with 1% β-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from d2 (n. 2 biological replicates) and d4 (n. 2 biological replicates) cells with QIAzol lysis reagent (Qiagen #79306), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Microbiology 2019Quote: Total RNA was extracted from frozen samples using two acid phenol-chloroform-isoamyl alcohol extractions and immediately purified using the RNEasy MinElute kit (Qiagen). Ribosomal RNA (rRNA ...
-
bioRxiv - Genomics 2019Quote: ... Four hundred µL of 70% ethanol were added and nucleic acid extraction was immediately done with the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... We extracted total genomic DNA from blood and/or tissue samples using standard nucleic acid extraction kits (QIAamp DNA Mini Kit; Qiagen) automated on a QiaCube (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were purified under denaturing conditions by nickel-nitrilotriacetic acid (NTA)-agarose affinity chromatography as described by the manufacturer (Qiagen). Polyclonal rabbit antisera were raised by Covance Research Products Inc ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted from stool samples using the RNeasy PowerMicrobiome kit automated on the QIAcube (Qiagen, Germantown, MD, USA), excluding the DNA degradation steps ...
-
bioRxiv - Microbiology 2021Quote: ... Total Nucleic Acid (TNA) was extracted from using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (Qiagen). Autopsy tissues were collected from lung ...
-
bioRxiv - Biophysics 2021Quote: ... MHC II with C-terminal hexahistidine tags on both α and β chains were expressed using a baculovirus expression system in S2 cells and purified using a Ni–nitrilotriacetic acid (NTA) agarose column (Qiagen). The histidine-tagged MHC bacmid (Malherbe et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant obtained after high speed centrifugation (20 000 x g for 30 min at 4 °C) was loaded on a gravity nickel-nitrilotriacetic acid (Ni-NTA) metal affinity column (Qiagen), washed with 10 column volumes (CV ...
-
bioRxiv - Microbiology 2020Quote: ... the samples were diluted further with RTL buffer to give a 1:60 w/v homogenate and total nucleic acid was extracted from 300 μl of the clarified sample using the RNA tissue mini kit without DNase (Qiagen) and eluted in a 60 μl volume.
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from yeast cells using either the acid phenol-chloroform method or an RNeasy Mini kit with on-column removal of DNA (Qiagen), both as previously described 28 ...
-
bioRxiv - Genomics 2021Quote: ... cfDNA extraction was performed using the QIAamp Circulating Nucleic Acid Kit using the 4-mL plasma protocol (Qiagen, product #55114). Prior to DNA elution ...
-
bioRxiv - Neuroscience 2022Quote: For the functional validation of the miR-124/Zfp36l1 interaction a custom made miRCURY locked nucleic acid (LNA) miRNA Power Target Site Blocker (TSB) (Qiagen) was used with the following sequence ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Biophysics 2022Quote: ... Supernatants were incubated with glutathione Sepharose (GSH) fast flow beads (GE-Healthcare) for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: Total viral RNA was extracted from deactivated samples using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (QIAGEN). One step reverse transcription to cDNA and real-time PCR (RT-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Developmental Biology 2019Quote: A locked nucleic acid (LNA) oligonucleotide probe antisense for the mature form of miR-92a-3p was designed and produced by Qiagen. The probe sequence was ACAGGCCGGGACAAGTGCAATA ...
-
bioRxiv - Biochemistry 2019Quote: ... and the lysate was mixed gently with 4 ml (50% slurry) of nickel-nitrilotriacetic acid (Ni-NTA)-agarose resin (Qiagen) at 4°C for 1 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... we utilized 4 mL of plasma and cfDNA was isolated using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany). The concentration of cfDNA was determined using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... Nucleic acids were purified from the lysates using the Qiagen AllPrep DNA/RNA mini kit (Qiagen Inc., Valencia, CA, USA), quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Purification of p53-(1-73) from the clarified cell lysate was accomplished using a Nickel Nitrilotriacetic Acid (Ni-NTA, Qiagen) column purification and 50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: His-FlhAC and His-FlgN were purified by Ni affinity chromatography with a nickel-nitriloacetic acid (Ni-NTA) agarose column (QIAGEN) as described previously12 ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR reactions were performed using the miRCURY LNA SYBR Green PCR Kit and the following locked nucleic acid (LNA) SYBR green primers from Qiagen: mmu-miR-598-3p ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated by extraction with hot acid phenol essentially as described in (67) and purified using an RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... using Qiagen DNA Blood and Tissue Mini kit on a QIAcube automated nucleic acid extraction system following manufacture’s protocol (Qiagen, MD). The nine whole-genome resequencing samples were extracted from ear pinna by mincing the tissue and incubating it overnight in 200 ug/ml Proteinase K at 55 °C with gentle shaking ...
-
bioRxiv - Physiology 2021Quote: ... We infected Sf9 cells with the recombinant virus to express and purify the His-tagged proteins using a nickel-nitrilotriacetic acid (Ni-NTA, Qiagen) column ...
-
bioRxiv - Neuroscience 2021Quote: ... The frozen brain tissue blocks of WRM and BF were boiled for 8 min and homogenized in 5% acetic acid using a TissueLyser LT (Qiagen) for 6 min at 50 Hz ...
-
bioRxiv - Cell Biology 2021Quote: Formalin-fixed paraffin-embedded tissues were used for in situ hybridization (ISH) employing locked nucleic acid (LNA) probes labelled with digoxigenin (DIG) at both the 5′- and 3’-ends (Qiagen). ISH was performed with probes specific for miR-132-3p (10 nM ...
-
bioRxiv - Immunology 2021Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Biophysics 2021Quote: ... Capture probes that contained locked nucleic acid (LNA) residues were purchased either from IDT with a 5′ Cy3 modification and HPLC purification or from Qiagen with a 5′ amino modification with HPLC purification ...