Labshake search
Citations for Qiagen :
351 - 400 of 1754 citations for 7 Bromo 6 methyl 2 propylquinoline 4 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Developmental Biology 2019Quote: RNA was extracted from pools of 6 × 105 FACS-isolated cells using the miRNeasy Micro Kit (Qiagen). Quantification of total RNA was performed by Qubit® RNA BR Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected in 10 cm2 or 6-well plates at ∼60% confluency using PolyFect (Qiagen 301107) and washed with complete media 6 h later.
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA (at least 6 μg) was extracted using the RNeasy Plant Mini kit (Qiagen, Hilden, Germany), with an additional step to remove contaminating DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... 6 and 48 HAT to ammonium or nitrate amended plates using RNeasy® Plant Mini kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated from 5-6 replicated lung slices from each treatment using miRNeasy Mini Kit (Qiagen) at time 0 and time 120 hours for all groups ...
-
bioRxiv - Molecular Biology 2020Quote: SH-SY5Y cells plated in 6-well plates were lysed using 750ul of QIAzol Lysis reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... GAS and SOL muscles from 6 mice per group were pulverized and lysed in RLT buffer (Qiagen) and treated with proteinase K (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR cycles were run as described elsewhere 6 but using a Rotor Gene-Q instrument (QIAGEN, GER). To quantify the relative abundance of Cori and ter chromosomal regions in each sample ...
-
bioRxiv - Immunology 2022Quote: BMDMs were grown in 6-well plates and RNA was isolated using the RNeasy Mini kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA from cardiomyocytes was obtained on day 6 post adenovirus infection using the RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from cortical neurons on 6 cm dishes using RNeasy Plus Mini Kit (QIAGEN, 74134) and reverse-transcribed using SuperScript II (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: Amplification was carried out in a Rotor Gene thermocycler 6-plex with Quantitect Multiplex PCR kit (Qiagen) with 0,24μM of each primer y 0,25μM of each probe under the following conditions ...
-
bioRxiv - Bioengineering 2023Quote: ... gDNA was purified from cells in 6-well plates using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Fibroblasts were grown to confluency in 6-well plates and total RNA extracted using RNeasy Kit (Qiagen). Poly(A)-tailed RNA enrichment and library construction was performed using KAPA stranded mRNA-Seq Kit with KAPA mRNA capture beads (KAPABiosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... the ViiA 7™ Real-Time PCR system was used to run the Human Stem Cell RT² Profiler™ PCR Array (Qiagen, Hilden, Germany). For the analysis of cardiac differentiation-associated genes ...
-
bioRxiv - Systems Biology 2020Quote: ... the MoBioPowersoil 96 kit (now Qiagen Cat No./Id: 12955-4) was used with minor modifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4-5 hours later DNA was transfected using Attractene (Qiagen). Briefly ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL of Buffer D2 (REPLI-g Single Cell Kit, Qiagen) and 1 μL of 500 μM exonuclease-resistant random primer were then added to the lysed cells to denature the DNA prior to vortexing ...
-
bioRxiv - Cell Biology 2022Quote: ... and TBT (4 biological replicates per condition) with RNeasy columns (Qiagen), followed by oligo-dT selection ...
-
bioRxiv - Systems Biology 2023Quote: ... or 4 pmol total negative control siRNA (Allstars negative control, Qiagen), were transfected using the Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated on 4-12% Bis-Tris gels (Novex, Qiagen) using MOPS running buffer (Novex ...
-
bioRxiv - Microbiology 2021Quote: Confluent 6-well plates of BAC16-iSLK.RTA cells were lysed using a DNeasy Blood and Tissue Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... Paired-end reads were mapped to the transcriptome (above) using default settings on CLC Genomics Workbench 6 (Qiagen) except that read alignments were done with a relaxed length fraction of 0.5 ...
-
bioRxiv - Genomics 2020Quote: ... We extracted genomic DNA from the above 6 stocks individually by using DNeasy blood and tissue kit (Qiagen), and measured the purity and concentration of the resulting DNA with NanoDrop ND-1000 spectrophotometer (Thermofisher) ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was collected from a single 6 cm dish using the DNEasy Blood & Tissue kit (69504, Qiagen). For both reps of day 0 ...
-
bioRxiv - Systems Biology 2020Quote: Three milliliters of cells from mid-log phase cultures were mixed with 6 mL RNAprotect Bacteria Reagent (Qiagen). Samples were mixed immediately by vortexing for 5 s ...
-
bioRxiv - Microbiology 2020Quote: ... The 6 × his-tagged proteins were purified using a nickel-nitrilotriacetic acid (Ni-NTA) agarose matrix (30250, Qiagen). Cell-free extracts were loaded on 0.5 ml Ni-NTA matrixes and incubated on a roller shaker for 2 h at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... IL-6 and β-actin cDNA were determined by QuantiFast SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) at the conditions ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted from cells grown in 6-well plates using RNeasy Mini Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... for 30 minutes at 37°C followed by beadbeating with 50μg 0.1mm zirconium beads for 6 minutes on the Tissuelyzer II (Qiagen) prior to loading onto the Qiacube HT ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were transiently transfected in 6 cm Ø dishes using Effectene Transfection Reagent according to manufacturer’s instructions (Qiagen) two days before the measurement ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted from infiltrated patches of 16C leaves at 6 dpi using TRIzol® Reagent (Qiagen). RNA concentration and RNA purity were measured using Nanodrop (ND-1000 ...
-
bioRxiv - Microbiology 2023Quote: ... and up to 6 ml of culture per isolate per medium was harvested using Bacterial RNAprotect (Qiagen 76506). Three biological replicates were generated for each condition.
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from frozen Hepa 1-6 cell pellets using the RNeasy Mini kit (74106, QIAGEN) following the manufacturer’s instructions with an on-column DNase digestion step (79254 ...
-
bioRxiv - Physiology 2024Quote: ... The apical portion was homogenized in tissue lysis buffer (Supplement Table 6.) using a bead mill (Qiagen, TissueLyserII). Homogenates were sonicated ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... were homogenized in 2-mL tubes containing lysis buffer plus 1% 2-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless-steel beads (Qiagen #69989 ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated from cultures infected with rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 using the QIAamp Viral RNA mini kit (Qiagen) and cDNA synthesis was performed using SuperScript III using hexamers (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from control (n = 2) and olaparib-treated (n = 2) GTFB-PDX1009 ascites using the RNeasy Plus Mini kit (Qiagen). RNA quality was confirmed using an Agilent TapeStation and all RNA used for library preparation had a RIN>9 ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...
-
bioRxiv - Physiology 2023Quote: ... the RNAs from livers (n = 2 mice/group, each group contains RNAs pooled from 2 mice) were prepared (RNeasy, Qiagen). Ribosomal RNA was removed with the Ribozero HMR Gold kit (Illumina).