Labshake search
Citations for Qiagen :
51 - 100 of 869 citations for 7 Bromo 4 chloro 6 methylquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted from 7 days old protonema using DNeasy Plant Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA was isolated from 7 days old protonemata with RNeasy Plant Mini Kit (Qiagen), treated with DNaseI (DNA-free™ DNA Removal Kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA isolation from 7 PDXs was performed with the Qiagen RNA Kit (Qiagen, Hilden, Germany). Sample quality was assessed using Agilent RNA 6000 Nano Reagent on Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... and collected into a PCR tube containing 7 µL of 2×TCL lysis buffer (Qiagen) with 2% v/v 2-mercaptoethanol (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... The 488 SRAs were assembled using skesa (74) or the CLC Genomics Workbench 7 (QIAGEN) using default parameters ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was isolated from 7-days-old protonemata with RNeasy Plant Mini Kit (Qiagen), treated with DNaseI (DNA-free™ DNA Removal Kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... reads from the two fastq files were paired using CLC Genomics Workbench 7 (Qiagen, Germany). Paired and unpaired data were uploaded and analysed on the public server at usegalaxy.org (48) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tissues were weighed and homogenized in 4 volumes of water (4 µL of water/mg tissue, 4°C) using a bead beater (TissueLyser II, QIAGEN; Germantown, MD). Aqueous homogenates were profiled using four complimentary liquid chromatography tandem mass spectrometry (LC-MS ...
-
bioRxiv - Genomics 2022Quote: ... 400 nL of protease mix (6 μg protease (Qiagen, 19155), 6.25x NEBuffer 4 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 6 and 9 employing the RNeasy plant mini kit (Qiagen). RNA was quantified using Nanodrop (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... For MUS81 interference it was used FlexiTube HsMUS81 6 (Qiagen). SMARCAL1 was depleted using the MISSION esiRNA HUMAN SMARCAL1 (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2023Quote: ... 6 million PBMCs were lysed using QIAzol Lysis Reagent (Qiagen). Samples were stored at -80°C until RNA extraction ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 µg C19orf43 (purified from E. coli BL21 through Qiagen Ni-TA agarose using standard procedures ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 mL of Ni2+-NTA slurry (Qiagen, Venlo, LI, Netherlands) were equilibrated in a gravity flow column with Wash Buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... UniSpike 6 (included in the QIAGEN miRCURY LNA RT Kit) to verify the efficacy of reverse transcription (RT ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from 7 day-old seedlings with the RNeasy Plant Mini Kit (Qiagen). 300 mg of total RNA were reverse transcribed with ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted from 7-day-old seedlings using RNeasy® Plant Mini-Kit (QIAGEN) and treated with RNase-Free DNase (QIAGEN) ...
-
bioRxiv - Cell Biology 2022Quote: COS-7 cells were transfected with the respective Myc-Sun4-pEGFP fusion constructs using EffecteneTM (Qiagen) following the manufacturer’s protocol and incubated overnight before analysis of the ectopically expressed fusion proteins.
-
bioRxiv - Immunology 2020Quote: ... skin was homogenized in TRIzol using two 7 mm metal beads and a TissueLyser LT (Qiagen). Homogenates were centrifuged to separate an RNA containing aqueous phase ...
-
bioRxiv - Genetics 2020Quote: DNA from 7-day old leaves was extracted for all genotypes using the QIAamp kit (Qiagen) on the QIAcube HT (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... DNA from ~7×106 cells was extracted using a Blood & Cell Culture DNA Midi Kit (QIAGEN) and amplified to examine the coverage of mutant cell libraries ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 7-day-old roots using the RNeasy Plant Mini Kit (Qiagen) and QIAcube (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... For SAS-6 knock down experiments siNegative control (siNegative, Qiagen, 1027310) and siSAS-6 (siSAS6 on-TARGET smart pool ...
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Cell Biology 2020Quote: Adrenal glands were homogenized in ammonium-bicarbonate buffer (150 mM ammonium bicarbonate, pH 7) with TissueLyser (Qiagen). Protein content was assessed using BCA Protein Assay Kit (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2021Quote: DNA was extracted from 0.5-7 mg biomass using DNeasy Powersoil microbial extraction kit (Qiagen, Hilden, Germany) accordingly to manufacturer’s instructions and stored at -20°C ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA was isolated from roots of 7-day-old seedlings using RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and 7 were isolated using a Plant RNeasy Mini kit with DNase I treatment (Qiagen, Hilden, Germany). Three biological replicates were prepared for each tissue type ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA from the MC.7.G5 clone was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and from blood by using either DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Microbiology 2019Quote: ... using a MagAttract PowerMicrobiome DNA/RNA Kit (27500-4 EP/27500-4 EP-BP, Qiagen, Hilden, Germany). Amplicon library preparation and sequencing were done as described previously [35] ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from the gut samples (7-10 guts/sample) using the RNeasy Mini kit (Qiagen) and the on-column DNase I treatment (79254 ...
-
bioRxiv - Biochemistry 2021Quote: ... supernatant was harvested after 7 days of expression and incubated with 300 μL of Ni-NTA resin (Qiagen) at 4°C overnight ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was extracted from seedlings 7 dpg using the RNeasy Plant RNA Extraction kit (Qiagen Ltd., Surrey, UK). RT-PCR was performed using the OneStep RT-PCR kit (Qiagen ...
-
bioRxiv - Bioengineering 2022Quote: Tissue samples at day 0 and 7 were collected from devices and dissociated in the lysis buffer (Qiagen) by agitating with an electronic pestle for 1 min ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from MCF-7 cells (1×106 cells/well) was isolated using RNeasy Mini kit (74106; Qiagen), and 500ng cDNA was synthesized with random hexamers by reverse transcription (SuperScript III ...