Labshake search
Citations for Qiagen :
251 - 300 of 3867 citations for 7 Bromo 3 4 dihydro 1H benzo e 1 4 diazepine 2 5 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... After vortexing the samples for 10 s and lysing the tissue with 4 mm glass beads for 1 min at 30 Hz in the TissueLyser II (Qiagen), 400 μL of Tris-HCl pH:7.5 were added and the samples were again mixed for 1 min in the TissueLyser ...
-
bioRxiv - Immunology 2020Quote: RNA was extracted from isolated neutrophils after the 1 and 4 hour EC challenges as well untreated controls using the miRNeasy Micro kit from Qiagen and libraries were generated using KAPA PolyA enrichment mRNA library prep ...
-
bioRxiv - Genomics 2021Quote: ... To eliminate lipids supernatants were applied to a RNeasy column and centrifuged at 10,000 rpm and 4 °C for 1 min (Qiagen, 74104). The flow through was collected and protein concentrations were assessed using the Bradford assay ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.4 mg/mL Proteinase K (55°C for 1 hour) before being purified using the QIAquick PCR purification kit (QIAGEN). qPCR was performed on the Rotor-Gene 3000 (Corbett Life Science ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting mixture was rotated at 4 °C for 60 min and then poured into a 1 mL polypropylene column (Qiagen). The resin was washed three times with 5 mL lysis/wash buffer and eluted in 0.25 mL fractions with Ni-NTA elution buffer (composition same as lysis/wash buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... previously coated with the anti-B55δ antibody (1 hour incubation at 4°C, followed by extensive washes) and Nickel beads (Qiagen) coated with 400 μg of 6XHIS-S67thio-S109A-XeARPP19 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Biochemistry 2024Quote: ... The cell pellet was removed after centrifugation (16000 rpm, 4 °C, 1 h) and supernatant was loaded into a Ni-NTA agarose column (Qiagen). Protein was eluted in an elution buffer (50 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA sequence (5’-GAGUAGAACUAGAAUGUGA-3’) targeting Hec1 was synthesized by Qiagen. The ON-TARGETplus SMARTpool siRNA sequences (5’-GAACGAGUAACCACAAUUA-3’) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen), pools of siRNAs targeting the TP53 sequence 5’-GAAAUUUGCGUGUGGAGUA-3’ ...
-
bioRxiv - Genomics 2021Quote: ... The scramble-miR miRCURY LNA Detection probe (5’-GTGTAACACGTCTATACGCCCA-3’, YD00699004, QIAGEN) was used as a negative control ...
-
bioRxiv - Genetics 2020Quote: ... The 3’ and 5’ – DIG labeled miRCURY LNA miRNA Detection probes (Qiagen, negative control Scramble-miR cat ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... single MR1-tetramer-binding cells from Peruvian participant 7-3 and blood bank donors 702A and 703A were sorted into 96-well plate coated with Vapor-Lock (Qiagen) containing Iscript cDNA synthesis mixture (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... After 14 h binding to 4 mL Ni-NTA agarose beads (Qiagen), the beads were first washed with 15 mL Ni-NTA binding buffer and then with 15 mL Ni-NTA wash buffer (1 M NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 µL of DNA) and run in Rotor-Gene Q machine (QIAGEN). Primer sequences are listed in the table S2 ...
-
bioRxiv - Bioengineering 2021Quote: ... Sample supernatants were incubated with 4 mL of Ni-NTA Agarose (Qiagen) for >1 hour at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... and pooled using the UltraClean 96 PCR Cleanup kit (Qiagen 12596-4) and Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen Q33120) ...
-
bioRxiv - Microbiology 2022Quote: ... and pooled using the UltraClean 96 PCR Cleanup kit (Qiagen 12596-4) and Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen Q33120) ...
-
bioRxiv - Genomics 2022Quote: ... and 4 µl of 100 mg/ml RNase A (QIAGEN, cat# 19101) were added to the homogenate ...
-
bioRxiv - Biochemistry 2020Quote: ... Crystallization screening was performed at 4°C with JCSG core I (Qiagen) using the sitting drop vapor diffusion method ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μl of DNA) and run in Rotor-Gene Q machine (Qiagen). Primer sequences are listed in the Table 2 ...
-
bioRxiv - Microbiology 2021Quote: ... Removed culture was mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) for stabilization and incubated for 5 min at room temperature before centrifugation at 4000 rpm for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... with 4 × 108 copies of cel-miR-39 miRNA mimic (Qiagen 339390) spiked into to the sample after addition of lysis buffer.
-
bioRxiv - Microbiology 2023Quote: ... The siRNAs were selected from the FlexiTube GeneSolution 4 siRNA sets (Qiagen) and transfected as a mix at 24 nM in Calu-3 and 10 nM in Caco-2 following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... At least 4 colonies were used for each DNA miniprep (QIAprep, Qiagen) and mutations were confirmed by Sanger sequencing (Source Bioscience) ...
-
bioRxiv - Neuroscience 2023Quote: ... at a frequency of 28/s @ 4°C (Tissue Lyser II, Qiagen). After this step the samples were adjusted to RT for 5 minutes and processed using the RNeasy Lipid Tissue Mini Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7.5 at 4°C) and purified using the RNAeasy kit (Qiagen).
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2020Quote: ... Pellets were lysed by vortexing for 1 minute in 350uL cold supplemented RLT buffer (RLT + β-MeOH) at 4°C and lysates homogenized using QIAshredder columns (Qiagen). RNA was then extracted from these samples using the RNeasy Plus Micro kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which we select the top 250 genes for which the correlation coefficient was positive and the top 250 genes for which the correlation coefficient was negative. The final step of the pipeline (Fig. 1 (4)) analyzes these genes by using Ingenuity Pathway Analysis (IPA, QIAGEN, [27]) to interpret the canonical pathways.
-
bioRxiv - Genomics 2019Quote: ... Purified products were loaded onto a 2% E-gel and gel extracted using a QiaQuick Gel Extraction kit (Qiagen 28704). The molarity of the gel-extracted PCR product was quantified using KAPA library quant (KK4824 ...
-
bioRxiv - Genetics 2019Quote: ... purified using an E-gel electrophoresis system (Agarose 2%) followed by column purification with a MinElute PCR Purification Kit (Qiagen). In order to introduce the doped sequence in the full-length TDP-43 sequence the purified oligonucleotide was cloned into 100 ug of linearized pRS416 Gal TDP-43 by a Gibson approach (Supplementary Table 1 ...
-
bioRxiv - Microbiology 2021Quote: The cells were lysed by high speed vortexing for 2 minutes using lysing matrix E tubes (MP Biomedical) in buffer RLT (Qiagen) amended with 1% 2-mercaptoethanol ...
-
bioRxiv - Microbiology 2023Quote: ... preceded by a 10-minute bead-beating step at 30 Hz in 2 ml e-matrix tubes (MP Biomedical, USA) using a Tissuelyser II (Qiagen). Molarity and fragment-length distribution of the extracts were measured using a Tapestation ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time PCR assays were carried out in triplicate to amplify the Wolbachia wsp gene [43] and host reference gene GAPDH (378 F_ 5’-CCGGTGGAGGCAGGAATGATGT-3’, 445 R_5’-CCACCCAAAAGACCGTTGACG-3’) on a Rotor-gene Q Instrument (Qiagen, NSW, Australia). Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... Clarified lysate was mixed with Ni-NTA agarose at 4℃ for 2h (Qiagen). Bound protein was eluted in 20 mM Tris pH 8.0 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lysates were treated with 4 μl of 100 mg/ml RNase A (QIAGEN) at 37 °C shaking at 500 RPM for 3 hours ...
-
bioRxiv - Immunology 2021Quote: ... and kept at 4°C RNA was purified using RNEASY Mini Kit (Qiagen) and its concentration determined using a Nanodrop 1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... 4°C for 10 min and the pellet was lysed with RLT+ (Qiagen). For scRNA-sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... at 4°C until RNA was extracted using the RNeasy Mini Kit (Qiagen)
-
bioRxiv - Microbiology 2020Quote: The MoBio PowerSoil-htp 96 kit (now Qiagen Cat No./Id: 12955-4), with minor modifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... cell pellets were lysed in a 4% SDS buffer using a Qiashredder (Qiagen). Relative densitometry for western blots was determined using ImageJ software and normalized to the density of loading control β-ACTIN ...
-
bioRxiv - Microbiology 2021Quote: ... into a volume of 4 μL PBS sc 1X (Qiagen, Cat. No. 150345). To avoid evaporation of the PBS sc 1X during the sort ...
-
bioRxiv - Cell Biology 2019Quote: J774 cells were silenced using a pool of 4 different Flexitube siRNAs (Qiagen) for SYK with Lipofectamine RNAiMAX reagent as described previously 20 ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL of room temperature Stop solution (REPLI-g Single Cell Kit, Qiagen) was then added and the samples were vortexed and spun down ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 18 µl of Omniscript enzyme at 4 U/µl (Omniscript RT Kit, Qiagen), and 37 µl water ...