Labshake search
Citations for Qiagen :
351 - 400 of 2752 citations for 7 Bromo 2H 1 3 benzodioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were homogenized in 1 ml cell culture medium (see above) and a 5 mm steel bead in a TissueLyser (Qiagen, Hilden, Germany). Fecal samples were vortexed in sterile NaCl and the supernatant was sterile filtered (22µm ...
-
bioRxiv - Immunology 2020Quote: YFP+ Treg cells were sorted from spleen and LN of WT or Usp22fl/flFoxp3YFP-Cre mice (n=5 per group) and total RNA was isolated from 1×106 cells per sample using an RNeasy Mini Kit (Qiagen, Cat# 74104) as previously described47 ...
-
bioRxiv - Genetics 2020Quote: ... 30 mg of snap frozen tissues were processed adding 1 ml of QIAzol reagent in presence of one 5 mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and isolated keratinocytes and fibroblasts from the skin and Wound7 (n = 5/each group) (Table 1 and Table S1) by using the miRNeasy Mini kit (Qiagen, Hilden, Germany) and prepared for library construction ...
-
bioRxiv - Cancer Biology 2023Quote: ... we adapted the same conditions used in Dip-C40 and lysed each nucleus in 150 nL of lysis buffer containing 20 mM Tris pH8/20 mM NaCl/25 mM DTT/0.15% Triton X-100/1 mM EDTA/5 µg/mL Qiagen Protease (Qiagen, cat. no. 19157). After dispensing ...
-
bioRxiv - Immunology 2024Quote: Genomic DNA was then isolated from 1-5 million isolated PBMCs using the DNeasy Blood and Tissue kit (Qiagen; Cat. No. 69504) following manufacturer instructions ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...
-
bioRxiv - Bioengineering 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 μL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Stainless steel 5 mm beads (Qiagen, Germany) were additionally sterilised by heating at 220°C for 3 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5 mm stainless steel beads (Qiagen) at 30 Hz for 3 min at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 mm stainless steel beads (Qiagen) for 4 minutes at 24,000 rpm ...
-
bioRxiv - Genetics 2023Quote: ... 5 ul of 5X Q-solution (Qiagen), 1 ul of 5 mM 7-deaza-dGTP (NEB) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAse A (5 μg/mL, Qiagen #19101) was added to the whole cell extracts (WCE ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.7 × 10−5 AU/mL protease (Qiagen), 1.0 μM barcoded oligodT-ISPCR primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mm diameter stainless steel bead (Qiagen) was added to all the tubes and the tissue was homogenised in TissueLyser II (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and stainless-steel beads (5 mm, Qiagen) before RNA isolation using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... using stainless steel beads (5 mm; Qiagen). RNA was then extracted using a RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: ... using 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3min (Qiagen/Retsch Bead Beater) ...
-
bioRxiv - Neuroscience 2024Quote: ... using 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3min (Qiagen/Retsch Bead Beater) ...
-
bioRxiv - Genomics 2024Quote: ... 5 µL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Genetics 2021Quote: Total RNA samples from kidneys and livers harvested from 7-week-old normal and cyli mice were prepared using RNeasy Mini kit (Qiagen, # 74104), treated with RQ1 RNase-Free DNase (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from 32D-Cas9 cell lines expressing sgRNAs targeting Cbl introns 7 and 8 using an RNeasy Mini Kit (QIAGEN, 74106). cDNA was prepared using a QuantiTect Reverse Transcription Kit (QIAGEN ...
-
bioRxiv - Bioengineering 2022Quote: RNA was isolated from hBSMC microtissues that were either untreated or treated with TGF-β1 and IL-13 for 7 days prior to RNA isolation using the RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Plant Biology 2022Quote: Two RNA samples from rosette leaves of after-bolting WT plants and bglu28/30-2 mutant plant grown under different S conditions and their 7-day-post-anthesis siliques were extracted with the RNeasy Plant Mini Kit (QIAGEN, Germany). The residual DNA was removed with DNase treatment (DNaseI ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 x 2 minute intervals at 25 Hz with the addition of one 7 mm stainless steel bead (Qiagen #69990). 200 uL of tissue lysate was used for KingFisher Flex (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... The insoluble fraction was solubilized in 7 M urea At-buffer and purified on a Ni-NTA mini-column (Qiagen Inc.) with At-buffer (100 mM Tris-HCl buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was extracted from the leaves harvested at 7 days after pathogen inoculation using a DNeasy Plant Mini Kit (Qiagen, Germany). Subsequently ...
-
HOIL-1L deficiency induces cell cycle alteration which causes immaturity of myocyte and fibrogenesisbioRxiv - Cell Biology 2023Quote: Total RNA was extracted from day 0 to day 7 of myotube differentiation using an RNeasy Mini Kit (Qiagen, Cat.# 74104) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... AC7594-5’-CCGCCTATCCTCGTCATGAAC)andcontrolALG9primers(AC5067-5’-CACGGATAGTGGCTTTGGTGAACAATTAC;AC5068-5’-TATGATTATCTGGCAGCAGGAAA GAACTTGGG) (0.5 µM) and QuantiTect SYBR Green PCR master mix (Qiagen) on a StepOnePlus Real-Time PCR machine (Applied Biosystems ...
-
bioRxiv - Bioengineering 2024Quote: ... A subset of the samples (5 g) was preserved in 5 mL RNA preservation solution (RNAprotect, QIAGEN, Hilden, Germany) and stored at -80°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Medium was stirred for 1 hour at 4°C in the presence of 5 ml Ni-NTA Agarose beads (Qiagen, Venlo, The Netherlands) washed with 25 mM Hepes-KOH pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were harvested (1×106) by centrifugation (200 x g for 5 min at 25°C. Whole RNA was isolated using the Qiagen RNeasy kit (Qiagen) according to the manufacturer’s description ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg target vector using PolyFect transfection reagent (Qiagen, 301107). Media containing virus was collected both 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Virus Precipitation Solution (System Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 3 min at 50 Hz using a TissueLyser LT (Qiagen) with 1 min incubation on ice in between homogenisations ...