Labshake search
Citations for Qiagen :
351 - 400 of 2698 citations for 7 Benzyl 2 oxa 7 aza spiro4.4nonan 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... proteins with log fold change >1 and Z-score > 2 were further analyzed in Ingenuity Pathway Analysis (IPA, Qiagen) to determine pathways enriched by the bait proteins ...
-
bioRxiv - Genomics 2022Quote: ... PCR#1 amplicons were selected on a 2% agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen). These amplicons were then used as template for “PCR#2” reactions ...
-
bioRxiv - Physiology 2022Quote: Frozen liver tissue was manually crushed and 30 mg per sample was homogenized in 1mL of 2:1 chloroform:methanol via a TissueLyser II (Qiagen). Samples were stored at 4 °C overnight with agitation ...
-
bioRxiv - Cancer Biology 2019Quote: ... tissue was digested away from the slide by incubating the tissue with 1% 2-mercaptoethanol in RLT buffer (Qiagen) for one hour at 56°C with interval shaking ...
-
bioRxiv - Cancer Biology 2020Quote: ... tissue was digested away from the slide by incubating the tissue with 1% 2-mercaptoethanol in RLT buffer (Qiagen) for one hour at 56°C with interval shaking ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins with log fold change >1 and Z-score > 2 were further analyzed in Ingenuity Pathway Analysis (IPA, Qiagen) to determine pathways enriched by the bait proteins ...
-
bioRxiv - Genomics 2020Quote: ... first strand synthesis was performed by incubating the pucks in 200 μL of reverse transcription solution (Maxima 1x RT Buffer, 1 mM dNTPs, 2 U/μL Lucigen NxGen RNAse inhibitor, 2.5 μM template switch oligo with Qiagen #339414YCO0076714 ...
-
bioRxiv - Genomics 2021Quote: ... Illumina reads for each genome were mapped to the yeast reference genome (R64-2-1, yeastgenome.org) using CLC-Genomics software (Qiagen). Resulting read mapping files were then subjected to copy number and heterozygous single nucleotide polymorphism (hetSNP ...
-
bioRxiv - Genomics 2022Quote: ... Illumina reads for each genome were mapped to the yeast reference genome (R64-2-1, yeastgenome.org) using CLC-Genomics software (Qiagen). Resulting read mapping files were then subjected to copy number and heterozygous single nucleotide polymorphism (hetSNP ...
-
bioRxiv - Microbiology 2022Quote: ... 1 to 2 mL of culture were mixed with the same volume RNAprotect™ Bacteria Reagent (Qiagen, Hilden, Germany) incubated for 10 min and centrifuged ...
-
bioRxiv - Genomics 2022Quote: ... After overnight proteinase K digestion in Lysis Buffer (Bionano Genomics) and one hour treatment with RNAse A (Qiagen), plugs were washed four times in 1x Wash Buffer (Bionano Genomics ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA was extracted from overnight cultures issued from one isolated colony following standard protocols (QIAGEN DNAeasy, Hilden, Germany). As controls ...
-
bioRxiv - Cell Biology 2021Quote: One µg of total RNA extracted from ELT3-V cells with the RNeasy Mini Kit (Qiagen, Germantown, MD) was reverse-transcribed into cDNA using amfiRivert cDNA Synthesis Master Mix (GenDEPOT ...
-
bioRxiv - Plant Biology 2021Quote: ... Sets of 95 ligations were pooled into one sample and purified using QIAquick PCR Purification Kit (Qiagen, Germany). The pooled ligation mixtures (5 μL ...
-
bioRxiv - Microbiology 2022Quote: ... the bacterial assemblage genomic DNA was extracted from one g of beads using DNeasy PowerSoil Pro kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... complementary DNA strand was synthesized from one μg of total RNA using QuantiTect® reverse transcription kit (Qiagen). Quantitative RT-PCR gene amplification was carried out using the CFX-96 thermocycler (Bio-Rad ...
-
bioRxiv - Pathology 2019Quote: ... RNA was extracted from PRRSV and one replicate of CDV using the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The quantitative real-time TaqMan based assay was carried out using a One-step RT-PCR kit (Qiagen) in the Light Cycler 2.0 system (Roche) ...
-
bioRxiv - Genetics 2021Quote: Long PCR products were purified by gel electrophoresis and short ones with the QIAquick PCR purification kit (Qiagen). Terminal adenine overhangs were added using Taq polymerase in the presence of dATP ...
-
bioRxiv - Genetics 2020Quote: ... reverse primers 852Rb-AGGAAGATAGAGAAAGAGCAACC and 852Rc-AGGAAGATAGAAAAGGAGCAACC using QIAGEN One-Step RT-PCR kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 5μL of the resulting DNA underwent one or more displacement amplifications using the Repli-G MDA kit (Qiagen), to enrich microbial DNA ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... One microgram of genomic DNA was bisulfite converted with the EpiTect® Fast 96 DNA Bisulfite Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... One hour of tagmentation at 37°C was followed by DNA extraction using MinElute PCR Purification Kit (Qiagen). Extracted DNA was subjected to PCR amplification using unique primers sets (Nextera XT v2 Full set (N7-S5)) ...
-
bioRxiv - Genomics 2019Quote: ... with the addition of 20 μl of proteinase K (20 mg/ml) followed by incubation at 56°C for 1-2 hr and the mitochondrial DNA was extracted by Qiagen DNeasy Blood & Tissue Kit (QIAGEN Inc.) ...
-
bioRxiv - Genomics 2019Quote: Total RNAs from the knockdown (shCTCF#1 and shCTCF#2) and control (shLuc) cells were extracted using miRNeasy Micro Kit (QIAGEN). cDNA was synthesized by using oligo (dT)20 and SuperScript III Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... longitudinal muscle/myenteric plexus preparations were homogenized in a 2 ml eppendorf containing 1 ml Trizol and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
Oligomerization state of the functional bacterial twin arginine translocation (Tat) receptor complexbioRxiv - Biophysics 2021Quote: ... The supernatant was loaded onto a 10 x 1 cm column with 2 mL Ni-NTA Superflow resin (Cat. #30230, Qiagen) that was pre-equilibrated with Buffer A (10 mM CAPS ...
-
bioRxiv - Molecular Biology 2020Quote: RNA was extracted from 14-day-old wild-type and acinus-2 pinin-1 seedlings using RNeasy mini kit (Qiagen) and treated with TURBO DNA-free Kit (Ambion ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: ... The retrieved tissue mROIs were deposited with 2 µl PBS into PCR tubes containing 18 µl of lysis buffer: 1:16 mix of Proteinase K solution (QIAGEN) in PKD buffer (QIAGEN) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... per condition or genotype were homogenized in 2-ml Eppendorf tubes containing lysis buffer with 1% beta-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless steel beads (Qiagen #69989) ...
-
bioRxiv - Neuroscience 2020Quote: ... GluA1 or GluA2Q (pIRES2-mCherry or pIRES2-EGFP) and CNIH2 (pRK5 or pBOS) plasmids were transfected at a 1:2 ratio using Effectene (QIAGEN) into adherent HEK293T cells (ATCC ...
-
bioRxiv - Genomics 2019Quote: ... 2D monolayers were lysed in RLT buffer supplemented with 1% 2-Mercaptoethanol before RNA purification using the RNeasy Mini Kit (QIAGEN) according to the manufacturer’s instructions and including the on-column DNase digestion step ...
-
bioRxiv - Microbiology 2019Quote: ... from the ME phase and ES phase (1 ml) were added to 4 ml and 2 ml of RNAprotect Bacteria Reagent (Qiagen), respectively ...
-
bioRxiv - Synthetic Biology 2020Quote: Cells were grown in triplicates on JMM 40 mM glycine and 40 mM pyruvate till mid-log phase and 1-2 mL of cultures were harvested and stabilized directly by RNA Protect Bacteria Kit (Qiagen). Cells were then lysed using lysozyme and beating with glass beads in a Retschmill (MM200 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue microregions were deposited with 2 µl PBS into PCR tubes containing 18 µl of lysis buffer: 1:16 mix of Proteinase K solution (QIAGEN) in PKD buffer (QIAGEN) ...
-
bioRxiv - Immunology 2021Quote: ... A total of 1-2 μg of RNA was used to synthesize the first single-strand cDNA using QuantiTect Reverse Transcription kit (Qiagen). For RT-PCR amplification ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Genomics 2021Quote: We began the assembly by first mapping long reads to the S288c reference genome (version R64-2-1) using CLC Genomics Workbench (Qiagen)(Fig ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from individual pools of 1×104 to 2×104 double-sorted SLAM cells using an RNEasy Micro kit (Qiagen). RNA was quantified and quality checked using an Agilent Bioanalyzer 2100 (Agilent) ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50uL of the dounce homogenized sample was labelled as “input” and added to 350uL RLT buffer with 1% 2-mercaptoethanol (Qiagen), followed by RNA extraction ...
-
bioRxiv - Biochemistry 2021Quote: ... and early stationary phase (OD = 1.0-1.3).1 mL sample of each culture was directly transferred to 2 mL RNAprotect cell reagent (Qiagen, Hilden, Germany). The samples were vortexed 5 sec ...
-
bioRxiv - Genomics 2022Quote: ... RNA (3 replicates each of V or E2 treated samples from donor 1 and donor 2) was DNAse treated and cleaned up using the RNeasy Mini kit (Qiagen) or the RNA Clean and Concentrator 5 kit (Zymo ...
-
bioRxiv - Immunology 2022Quote: Total RNA was prepared from 1-2*106 sorted naïve (CD25− CD44lowCD62high) or effector (CD25− CD44highCD62low) CD4+ T-cells using RNeasy Mini Kit (Qiagen Inc.) as described in manufacturer’s protocol including an on-column digestion step (RNaseFree DNase Set ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA (2 μg per sample) extracted from 1×106 BSCs was performed using the Qiagen RNA RNeasy Kit (Cat#74104, Qiagen) followed by library preparation with the Illumina TruSeq V2 Kit (Cat#20020594 ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Neuroscience 2024Quote: ... DRG and paw skin RNA was extracted using a RLT buffer:2-mercapto ethanol mixture in a 100:1 ratio/RNeasy (Qiagen) RNA mini kit according to the manufacturer’s instructions and spinal cord and spleen RNA was extracted using TRizol (Invitrogen)/RNeasy RNA mini kit ...