Labshake search
Citations for Qiagen :
251 - 300 of 1397 citations for 7 BENZYLOXY 3 METHYL 5 NITROINDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: RNA was extracted from root tips (1-2 mm) of 7-d-old seedlings using the RNEasy plant mini kit (QIAGEN), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA from plants grown for 7 days after germination in rhizoboxes was extracted with the RNeasy Plant Mini Kit (Qiagen) and first strand cDNA was synthesised with the RevertAid First Strand cDNA synthesis Kit (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... Quality control and de novo assembly of the reads were done using default parameters in CLC Genomics workbench 7 (Qiagen). Whole-genome alignment was performed using Mugsy v1.2.3 (55 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was isolated from liver and lung tissues (n=4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Mini Kit (Qiagen) and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Blood Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: Total mRNA was isolated from 2 dpf or 7 dpf zebrafish homogenates using the RNeasy Mini Kit (Qiagen, Cat# 74104) and reverse-transcribed with SuperScript VILO (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was extracted from 1×10^7 PBMCs using the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen, Hilden, Germany). Following nucleic acid isolation ...
-
bioRxiv - Developmental Biology 2019Quote: ... Cells with ESC like morphology were picked and 7 clones successfully expanded for genomic DNA isolation using DNeasy Blood and Tissue Kit (Qiagen) followed by genotyping using Taq DNA polymerase (Takara ...
-
bioRxiv - Plant Biology 2021Quote: DNA for bisulfite sequencing was isolated from dissected endosperm at 7 days after pollination using QiaAMP DNA microkit (QIAGEN 56304). Dissected tissue was obtained for two biological replicates for each genotype and incubated overnight in a shaker at 56°C in ATL buffer with Proteinase K ...
-
bioRxiv - Cell Biology 2021Quote: ... These M-cells were resuspended in 500 μl PBS pH 7.2 and mixed with 7 μl BioMag magnetic streptavidin beads (Qiagen, 311714) for 60 min at 4°C and loaded into an acrylic column with curved grade N52 magnet ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from freshly isolated T-cells on day 7 of treatment from spleens using RNeasy Kit (Qiagen). For each group ...
-
bioRxiv - Pathology 2023Quote: ... Skeletal muscle (triceps and Tibialis anterior (TA)) and spinal cord tissue samples underwent homogenization with 7 mm stainless steel beads (#69990, Qiagen) in a Tissue Lyser LT (#85600 ...
-
bioRxiv - Neuroscience 2023Quote: RNA was isolated from mature wildtype DA neurons following 7-day treatment with GluCer using the RNeasy Micro Kit (QIAGEN) and sent for bulk RNAseq to Azenta ...
-
bioRxiv - Immunology 2024Quote: TET2 knockout efficiency was confirmed by isolating genomic DNA from CAR T-cells at Day 7 using the dNeasy Blood & Tissue Kit (Qiagen). PCR of genomic DNA was performed with TET2 Forward Primer 5’-TCCCTGAGTCCCAGTCCATC-3’ and Reverse Primer 5’-TCAGGAATGGCCAGGTTCTG-3’ using MyTaq Red 2X Mix (Meridian Bioscience) ...
-
bioRxiv - Immunology 2023Quote: ... The resulting cell suspension was concentrated by centrifugation (7 min, 350 g) and lysed in RLT buffer(Qiagen, cat. 79216) 0.1-0.5 *10^6 lymphocytes /sample density ...
-
bioRxiv - Plant Biology 2024Quote: ... about 20 mg of tissue from 7-day-old seedlings was ground into fine powder in liquid nitrogen with a TissueLyser system (QIAGEN). Total proteins were extracted using denaturing buffer (100 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA from 7 of these patients was extracted from CD138+ cells using the miRNeasy Mini Kit (Qiagen GmbH, Germany) according to the manufacturer’s instruction ...
-
bioRxiv - Biophysics 2024Quote: ... where the band corresponding to the desired handle length (∼1.6 kb or 1.7 kb for LH and RH respectively) was excised and then the DNA extracted using a gel-extraction kit (Qiagen). The RNA hairpin substrate was then annealed and ligated between the LH and RH handles (see final construct configuration as in Fig ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 µg pINDUCER20-GFP-AFOS using PolyFect (Qiagen, 301107). Media was collected at 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Solution (System Biosciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Hoko-3 using a Genomic-tip kit (Qiagen, Hilden, Germany). Library preparation was performed using SMRTbell Express Template Prep Kit 2.0 (PacBio ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... then lysed 3 times in a pre-cooled TissueLyser (QIAGEN). Proteins were dissolved in lysis buffer (4% SDS ...
-
bioRxiv - Cell Biology 2019Quote: ... Table 3 in the Rotor Gene Q 2plex cycler (Qiagen).
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 3 mL of Ni-NTA resin (Qiagen) for 1.0 h at 4 °C and then applied to a gravity flow column ...
-
bioRxiv - Molecular Biology 2023Quote: ... were crushed with a tungsten carbide bead (3 mm, Qiagen) on a Retsch MM400 mixer mill for 60 seconds at 30 Hz and DNA was extracted using the DNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...
-
bioRxiv - Bioengineering 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 μL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Stainless steel 5 mm beads (Qiagen, Germany) were additionally sterilised by heating at 220°C for 3 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5 mm stainless steel beads (Qiagen) at 30 Hz for 3 min at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 mm stainless steel beads (Qiagen) for 4 minutes at 24,000 rpm ...
-
bioRxiv - Genetics 2023Quote: ... 5 ul of 5X Q-solution (Qiagen), 1 ul of 5 mM 7-deaza-dGTP (NEB) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAse A (5 μg/mL, Qiagen #19101) was added to the whole cell extracts (WCE ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.7 × 10−5 AU/mL protease (Qiagen), 1.0 μM barcoded oligodT-ISPCR primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mm diameter stainless steel bead (Qiagen) was added to all the tubes and the tissue was homogenised in TissueLyser II (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and stainless-steel beads (5 mm, Qiagen) before RNA isolation using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen ...