Labshake search
Citations for Qiagen :
151 - 200 of 2443 citations for 7 AMINO 1 3 NAPHTHALENEDISULFONIC ACID DISODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... The relative quantification of the genes of interest was carried out in a 10 μl reaction volume in white ultraAmp 384 well PCR plates (Sorenson, Bioscience, Salt Lake City, UT, USA) using the QuantiTect SYBR Green (Qiagen) and LightCycler® 480 system (Roche Diagnostics ...
-
bioRxiv - Physiology 2022Quote: ... Fifteen milligrams of liver were homogenized in 200 µL of a 3:3:2 solution of acetonitrile:isopropanol:water (MeCN:IPA:H2O) in ceramic bead tubes (1.4 mm, Qiagen #13113-50) using a TissueLyzer II (Qiagen #85300) ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant was applied to a nickel-nitrilotriacetic acid agarose (Qiagen) column and washed with 20 mM imidazole for twice ...
-
bioRxiv - Molecular Biology 2021Quote: ... Soluble fraction was incubated with Ni-nitrilotriacetic acid (NTA)-agarose (Qiagen) beads or glutathione-sepharose (GE Healthcare ...
-
bioRxiv - Biochemistry 2019Quote: ... but were purified using nickel-nitrilotriacetic acid resin (Qiagen, Germantown, MD). The final protein concentration was 15-260 μM (~2-10 mol ADP per mol kinesin) ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were purified using nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen) and the histidine tag was subsequently removed by thrombin digestion (10 U/mg of protein) ...
-
bioRxiv - Neuroscience 2022Quote: Locked Nucleic Acid (LNA) oligonucleotides for C21orf2 were purchased from Qiagen. A complete list of the used ASOs can be found in extended data table 6 ...
-
bioRxiv - Microbiology 2020Quote: ... The proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA; Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... which were purified by adsorption to nitrilotriacetic acid (NTA) agarose (QIAGEN) and elution with 25 mM NaH2PO4-150 mM NaCl-125 mM imidazole buffer (pH 8.0 ...
-
bioRxiv - Genomics 2021Quote: ... These kits included QIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany), Plasma/Serum Cell-Free Circulating DNA Purification Mini Kit (Norgen Biotek ...
-
bioRxiv - Cell Biology 2020Quote: ... lysed and incubated with nickel-nitrilotriacetic acid beads (Qiagen, Hilden, Germany) as per the manufacturer instructions ...
-
bioRxiv - Genomics 2020Quote: cfDNA was extracted using the QIAamp Circulating Nucleic Acid kit (Qiagen). Isolation of cfDNA was done from 1 mL of plasma ...
-
bioRxiv - Microbiology 2023Quote: ... The eluted nucleic acid was purified using the DNeasy Kit (Qiagen) and analyzed with RT-PCR strong stop primers (SSS ...
-
bioRxiv - Microbiology 2023Quote: ... The eluted nucleic acid was purified using the DNeasy Kit (Qiagen) and analyzed by qPCR with strong-stop primers (primers PR and PU5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (QIAGEN, cat # 30230) and the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified with Ni2+-nitrilotriacetic acid agarose beads (Qiagen) and desalted with Bio-Gel P-6DG gel (Bio-Rad) ...
-
bioRxiv - Genomics 2024Quote: ... Nucleic acid isolation was performed using the QIAcube (Qiagen, Hilden, Germany) and the PAXgene blood miRNA kit according to the manufacturer’s protocol to extract gene-encoding mRNAs ...
-
bioRxiv - Cancer Biology 2024Quote: ... and rEDA was purified using nickel-nitrilotriacetic acid-agarose resin (Qiagen).
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from 7 day-old seedlings with the RNeasy Plant Mini Kit (Qiagen). 300 mg of total RNA were reverse transcribed with ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted from 7-day-old seedlings using RNeasy® Plant Mini-Kit (QIAGEN) and treated with RNase-Free DNase (QIAGEN) ...
-
bioRxiv - Cell Biology 2022Quote: COS-7 cells were transfected with the respective Myc-Sun4-pEGFP fusion constructs using EffecteneTM (Qiagen) following the manufacturer’s protocol and incubated overnight before analysis of the ectopically expressed fusion proteins.
-
bioRxiv - Immunology 2020Quote: ... skin was homogenized in TRIzol using two 7 mm metal beads and a TissueLyser LT (Qiagen). Homogenates were centrifuged to separate an RNA containing aqueous phase ...
-
bioRxiv - Genetics 2020Quote: DNA from 7-day old leaves was extracted for all genotypes using the QIAamp kit (Qiagen) on the QIAcube HT (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... DNA from ~7×106 cells was extracted using a Blood & Cell Culture DNA Midi Kit (QIAGEN) and amplified to examine the coverage of mutant cell libraries ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 7-day-old roots using the RNeasy Plant Mini Kit (Qiagen) and QIAcube (Qiagen) ...
-
bioRxiv - Bioengineering 2020Quote: Around 250 mg of each produce sample was cut into 1-3 mm pieces using a scalpel and then processed with the DNeasy Powersoil Pro kit (Qiagen) to isolate 50μL of eluted DNA ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was purified 1-3 dpi from mock- or POWV-infected hBMECs or hPCs using RLT lysis buffer and RNeasy columns (Qiagen). Purified RNA was quantitated ...
-
bioRxiv - Genomics 2022Quote: ... Formalin-Fixed Paraffin-Embedded (FFPE) tissue (3 samples) and fresh frozen tissue (1 sample, QiaAmp Blood mini kit, QIAcube, QIAgen). Two samples are reference samples (NA24385 and NA12892 ...
-
bioRxiv - Genomics 2022Quote: ... the supernatants were mixed with Sigma HIS-Select Nickel Affinity Gel (at a ratio of 3:1) equilibrated in lysis buffer before being added into a polypropylene column (Qiagen). After extensive washing with a cold lysis buffer ...
-
bioRxiv - Cancer Biology 2022Quote: Spheroid and monolayer samples (technical replicates n=3) of MUC-1 and NCI-H295R cells were processed for RNA extraction using the RNeasy Mini kit (Qiagen), followed by DNA removal (TURBO DNA-free™ Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted from pooled (n=10) embryonic zebrafish and pooled (n=3) adult (> 1 year) heart samples by QIAGEN RNEasy Lipid Tissue Extraction kit according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: Bacterial RNA was isolated from LB cultures at OD600nm 1 and 3 in biological replicates using the QIAzol lysis reagent (Qiagen). The quantity of the bacterial RNA samples was measured on a NanoDrop ND1000 system and their quality analyzed on the Agilent 2100 Bioanalyzer system with the Agilent RNA 6000 Nano kit protocol (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The LNA gapmers for lnc-FLii-1 and lnc-LSAMP-3 were designed and purchased along with negative control LNA from Qiagen. For transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2023Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Microbiology 2023Quote: ... round 1 and 3 virus infections of GeCKO-A549 cells using the midi gDNA extraction kit (Qiagen, Germantown, MD, USA). The sgRNA’s DNA copies were PCR amplified from the extracted gDNAs for next generation sequencing (Fig 1) ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNAs were extracted from samples collected at same times from salt-treated or control plant batches using the RNeasy plus mini kit with gDNA eliminator (Qiagen, Germany). First-strand cDNAs were synthesized from 3 μg of RNAs using SuperScript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... Then the magnetic beads were washed in high salt buffer and RNA was extracted with the RNeasy Micro kit (Qiagen: 74004). For RNA sequencing ...
-
bioRxiv - Plant Biology 2021Quote: ... and salt treated samples (100 mM, 250 mM and 500 mM NaCl) was extracted using RNeasy Plant Mini Kit (Qiagen, Germany). RNA quality and quantity assessment ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA-bead complexes were washed in high and low salt buffer and RNA was eluted from the RNA-bead complexes using the Qiagen RNeasy Plus Micro Kit (Qiagen 74034). Isolated m6A-enriched RNA was immunoprecipitated a second time using 2 µg of a second anti-m6A antibody (Abcam ab151230) ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: Ni-NTA agarose beads (Qiagen 70666-3)
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...