Labshake search
Citations for Qiagen :
1 - 50 of 1374 citations for 7 8 Dihydroisoquinolin 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and 6h time points using the RNeasy Plus kit (QIAGEN). The RNAs were used as a template for cDNA synthesis followed by qRT-PCR to quantify mRNA level ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µM of forward and reverse oligos were heated for one minute at 100°C with 5 mM MgCl2 and 7 mM Tris-Cl (i.e. Qiagen Elution Buffer) and annealed by slowly cooling to room temperature.
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 5× One-step RT-PCR buffer (QIAGEN), 10 μL Triton-x100 (0.3% ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Immunology 2022Quote: ... corpus (segment 6-7) and cauda (segment 8-10) samples using QIAzol Lysis Reagent (Qiagen) following the manufactureŕs recommendation using a bead-based tissue homogenizer (Retsch ...
-
bioRxiv - Bioengineering 2023Quote: ... on a 5-plex QIAcuity One digital PCR instrument (Qiagen, 911021). The thermal cycling conditions were implemented using the following program ...
-
bioRxiv - Neuroscience 2022Quote: ... one 5 mm bead per sample was used in a TissueLyser (Qiagen) for 4 min at 30 Hz ...
-
bioRxiv - Bioengineering 2023Quote: ... on a 5-plex QIAcuity One digital PCR instrument (911021, Qiagen, USA). The thermal cycling conditions were implemented using the following program ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from RAW264.7 cells cultured for 6h using RNeasy kits according to manufacturer’s protocols (Qiagen, Denmark). After 24h culture ...
-
bioRxiv - Microbiology 2023Quote: ... containing 500 µl PBS and one 5 mm steel bead (Qiagen, Hilden, Germany) prior to bead-beating for 20 seconds to disrupt the cuticle ...
-
bioRxiv - Immunology 2021Quote: ... Twenty consecutive 10 μm sections were placed on glass slides for subsequent IHC (sections 1-2, 7-8, 13-14, & 19-20) or placed in 600 μl buffer RLT (Qiagen) containing 1% 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5mM EDTA (pH 8) together with a 5 mm stainless steel bead (Qiagen) and macerated at 1,200 rpm for 2 mins in the Geno/grinder followed by a 10-minute centrifugation (17,000 x g ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 x 2 minute intervals at 25 Hz with the addition of one 7 mm stainless steel bead (Qiagen #69990). 200 uL of tissue lysate was used for KingFisher Flex (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... The reactions were incubated for 15 min at 60 °C and then terminated by adding 1 μl 5 M NaOH to degrade RNA and heating at 95 °C for 5 min followed by neutralization with 1 μl 5 M HCl and one round of MinElute column clean-up (Qiagen). The R1R DNA adapter was adenylated by using a 5’ DNA Adenylation kit (New England Biolabs ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCGTCATCAGGATTGGCAA and probe 5’-TGGGTGTCTGCTTTGGAACA were used in a one-step qRT-PCR reaction with either Quantifast reagents (Qiagen) for tissue RNA or LightCycler 480 RNA Master Hydrolysis Probes (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... NHEJ reporter plasmid was digested with I-Sce1 for 6h and purified using a QIAEX II Gel Extraction Kit (QIAGEN). Exponentially growing cells were transfected using an Amaxa nucleofector with the U-023 program ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from 32D-Cas9 cell lines expressing sgRNAs targeting Cbl introns 7 and 8 using an RNeasy Mini Kit (QIAGEN, 74106). cDNA was prepared using a QuantiTect Reverse Transcription Kit (QIAGEN ...
-
bioRxiv - Genetics 2019Quote: ... for lysis in 2 ml safe-lock tubes containing one 5 mm stainless steel bead (Qiagen) for 2.5-3 minutes at 30 Hz using TissueLyzer II (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... One µg of purified RNA was treated twice with 5 µl of RNAse-free DNAse (Qiagen) and subjected to a final on column purification ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng equivalent of pooled total RNA (5 slices per animal; 7 rats) was used to synthesize cDNA using an RT First Strand Kit (Qiagen). Pre-validated primers targeting rat CXCR4 ...
-
bioRxiv - Neuroscience 2020Quote: RNA was extracted from third-instar larval CNS or adult heads (5-7 days post-pupation) with RNeasy Plus Micro kit (Qiagen). RNA isolation was followed with DNase digestion with Turbo DNA-free (Ambion) ...
-
bioRxiv - Cell Biology 2019Quote: ... The reaction was stopped using 15mM EDTA followed by incubation at 65°C for 5-7 min and purification on RNAeasy column (Qiagen). The purified RNA samples were processed for preparations of cDNA libraries using the TruSeq Stranded Total RNA Ribo-Zero H/M/R (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... and microbial Eukaryotic abundance with a QIAcuity One 5-plex digital PCR (dPCR) instrument (Qiagen Inc. USA, Germantown, MD). dPCR samples represented both the 416 Fire —across SBS ...
-
bioRxiv - Immunology 2020Quote: ... which contained 5 μl of sort buffer consisting of (1X Qiagen One-step RT PCR Buffer (Qiagen, Hilden, Germany), 0.1 mM dithiothreitol (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... 14-666-315) containing 1 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Nucleic acids were isolated from excised granulomas by homogenizing in TRIzol (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was stopped by adding 2.5 uL of 0.5M EDTA pH 8 and transposed DNA was purified using Qiagen MiniElute PCR purification kit (Qiagen). Purified DNA was amplified using the following condition ...
-
bioRxiv - Bioengineering 2021Quote: ... Total RNA (5 μl) was used for cDNA synthesis and qPCR was performed in one step using QuantiTect Probe RT-PCR (Qiagen) on a StepOnePlus System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl RNA was used in a one-step real-time RT-PCR using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: ... The eluted RNA from tissues and swabs was analyzed by one-step qRT-PCR using 5 μL input RNA with the QuantiFast Probe PCR kit (Qiagen) and primer/probe sets targeting the NiV Malaysia and HeV N gene ...
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Microbiology 2023Quote: ... calf muscle and pancreas were collected in 500 μl of PBS containing one (heart and pancreas) or two (calf muscle) 5 mm stainless steel beads (QIAGEN), homogenized with TissueLyser II (QIAGEN ...
-
bioRxiv - Microbiology 2022Quote: ... Organs were homogenized by high-speed shaking in 2 mL microcentrifuge tubes filled with sterile PBS and 5/7 mm stainless steel beads using TissueLyser LT (Qiagen, Hilden, Germany).
-
bioRxiv - Plant Biology 2023Quote: ... unexpanded leaves was extracted from 14 individuals (7 early-blooming, 5 late-blooming, and the two parents) with a DNeasy Mini Plant Kit (Qiagen, Hilden, Germany) and quantified with a Quant-iTTM PicoGreenTM dsDNA assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs used were: AllStars Negative control siRNA (cat# 1027281) and si-Rab13 #8 (cat# SI02662702; target sequence: 5’-ATGGTCTTTCTTGGTATTAAA-3’) from Qiagen.
-
bioRxiv - Microbiology 2021Quote: ... a volume equivalent to 5×108 cells were spun down (assuming 1 OD600=8×108 cells) and Protect Bacteria RNA Mini Kit (Qiagen) was used to extract total RNA as described in (Bhattacharyya et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... The frozen brain tissue blocks of WRM and BF were boiled for 8 min and homogenized in 5% acetic acid using a TissueLyser LT (Qiagen) for 6 min at 50 Hz ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA for PIWIL3 5′ RACE was extracted from the ovaries of 8-week-old golden hamsters using ISOGEN (Nippon Gene) and RNeasy (Qiagen). 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the sample was divided into 5 parts and each part was purified using one PCR purification columns (PCR purification kit, Qiagen 28106). 50ul elution buffer was used the elute each column ...
-
bioRxiv - Genomics 2022Quote: The second lobe of lung or trachea was immersed in 1 mL PBS in a 2 mL Micro Centrifuge Tube (Fisherbrand, 14-666-315) containing one stainless steel bead (5 mm, QIAGEN, 1026563) immediately after dissecting the SARS-CoV-2 infected mouse or hamster ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 ng of each PCR product was pooled into one tube for purification using the QIAquick PCR purification kit (Qiagen #28106) and eluted into 30 µL Nuclease Free Water ...
-
bioRxiv - Genomics 2022Quote: ... One mL of Qiazol (Qiagen) was added to an aliquot of 150 μl of plasma per sample ...
-
bioRxiv - Immunology 2023Quote: ... One stainless steel bead (Qiagen) was added per sample and liver tissues were homogenized using the TissueLyser LT (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Barcoded libraries (One-step, Qiagen) were then run on MiSeq or NextSeq Illumina sequencers ...
-
bioRxiv - Genetics 2020Quote: ... 30 mg of snap frozen tissues were processed adding 1 ml of QIAzol reagent in presence of one 5 mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... Using the CLC genomics workbench 7 (Qiagen), reads were mapped to the S ...