Labshake search
Citations for Qiagen :
401 - 450 of 2761 citations for 7 8 Dihydro 6H 1 6naphthyridin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... These M-cells were resuspended in 500 μl PBS pH 7.2 and mixed with 7 μl BioMag magnetic streptavidin beads (Qiagen, 311714) for 60 min at 4°C and loaded into an acrylic column with curved grade N52 magnet ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from freshly isolated T-cells on day 7 of treatment from spleens using RNeasy Kit (Qiagen). For each group ...
-
bioRxiv - Pathology 2023Quote: ... Skeletal muscle (triceps and Tibialis anterior (TA)) and spinal cord tissue samples underwent homogenization with 7 mm stainless steel beads (#69990, Qiagen) in a Tissue Lyser LT (#85600 ...
-
bioRxiv - Neuroscience 2023Quote: RNA was isolated from mature wildtype DA neurons following 7-day treatment with GluCer using the RNeasy Micro Kit (QIAGEN) and sent for bulk RNAseq to Azenta ...
-
bioRxiv - Immunology 2024Quote: TET2 knockout efficiency was confirmed by isolating genomic DNA from CAR T-cells at Day 7 using the dNeasy Blood & Tissue Kit (Qiagen). PCR of genomic DNA was performed with TET2 Forward Primer 5’-TCCCTGAGTCCCAGTCCATC-3’ and Reverse Primer 5’-TCAGGAATGGCCAGGTTCTG-3’ using MyTaq Red 2X Mix (Meridian Bioscience) ...
-
bioRxiv - Immunology 2023Quote: ... The resulting cell suspension was concentrated by centrifugation (7 min, 350 g) and lysed in RLT buffer(Qiagen, cat. 79216) 0.1-0.5 *10^6 lymphocytes /sample density ...
-
bioRxiv - Plant Biology 2024Quote: ... about 20 mg of tissue from 7-day-old seedlings was ground into fine powder in liquid nitrogen with a TissueLyser system (QIAGEN). Total proteins were extracted using denaturing buffer (100 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA from 7 of these patients was extracted from CD138+ cells using the miRNeasy Mini Kit (Qiagen GmbH, Germany) according to the manufacturer’s instruction ...
-
bioRxiv - Biophysics 2024Quote: ... where the band corresponding to the desired handle length (∼1.6 kb or 1.7 kb for LH and RH respectively) was excised and then the DNA extracted using a gel-extraction kit (Qiagen). The RNA hairpin substrate was then annealed and ligated between the LH and RH handles (see final construct configuration as in Fig ...
-
bioRxiv - Genomics 2022Quote: ... After overnight proteinase K digestion in Lysis Buffer (Bionano Genomics) and one hour treatment with RNAse A (Qiagen), plugs were washed four times in 1x Wash Buffer (Bionano Genomics ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA was extracted from overnight cultures issued from one isolated colony following standard protocols (QIAGEN DNAeasy, Hilden, Germany). As controls ...
-
bioRxiv - Cell Biology 2021Quote: One µg of total RNA extracted from ELT3-V cells with the RNeasy Mini Kit (Qiagen, Germantown, MD) was reverse-transcribed into cDNA using amfiRivert cDNA Synthesis Master Mix (GenDEPOT ...
-
bioRxiv - Plant Biology 2021Quote: ... Sets of 95 ligations were pooled into one sample and purified using QIAquick PCR Purification Kit (Qiagen, Germany). The pooled ligation mixtures (5 μL ...
-
bioRxiv - Microbiology 2022Quote: ... the bacterial assemblage genomic DNA was extracted from one g of beads using DNeasy PowerSoil Pro kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... complementary DNA strand was synthesized from one μg of total RNA using QuantiTect® reverse transcription kit (Qiagen). Quantitative RT-PCR gene amplification was carried out using the CFX-96 thermocycler (Bio-Rad ...
-
bioRxiv - Pathology 2019Quote: ... RNA was extracted from PRRSV and one replicate of CDV using the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The quantitative real-time TaqMan based assay was carried out using a One-step RT-PCR kit (Qiagen) in the Light Cycler 2.0 system (Roche) ...
-
bioRxiv - Genetics 2021Quote: Long PCR products were purified by gel electrophoresis and short ones with the QIAquick PCR purification kit (Qiagen). Terminal adenine overhangs were added using Taq polymerase in the presence of dATP ...
-
bioRxiv - Genetics 2020Quote: ... reverse primers 852Rb-AGGAAGATAGAGAAAGAGCAACC and 852Rc-AGGAAGATAGAAAAGGAGCAACC using QIAGEN One-Step RT-PCR kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 5μL of the resulting DNA underwent one or more displacement amplifications using the Repli-G MDA kit (Qiagen), to enrich microbial DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... One microgram of genomic DNA was bisulfite converted with the EpiTect® Fast 96 DNA Bisulfite Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... One hour of tagmentation at 37°C was followed by DNA extraction using MinElute PCR Purification Kit (Qiagen). Extracted DNA was subjected to PCR amplification using unique primers sets (Nextera XT v2 Full set (N7-S5)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... total miRNAs were extracted from 8-µm thick FFPE tissues by using a miRNeasy FFPE kit (Qiagen). Among them ...
-
bioRxiv - Genomics 2021Quote: ... The cells were harvested 8-21d post-transfection and genomic DNA and RNA were immediately collected (Qiagen; DNeasy #69504 and RNeasy #74106 ...
-
INTEGRATE: Model-based multi-omics data integration to characterize multi-level metabolic regulationbioRxiv - Systems Biology 2021Quote: Total RNA was extracted from at least 8 x 106 cells by using RNeasy Mini Kit (Qiagen). Each pellet was resuspended by adding 30 μL of RNAse-free water ...
-
bioRxiv - Biochemistry 2020Quote: Initial hits of Nic96186-839-VHH-SAN12 were obtained at 18 °C in 1 day in a 96-well sitting drop tray with a reservoir containing 8% (w/v) PEG 8,000 and 0.1 M tri-sodium citrate pH 5.0 (Protein Complex suite, Qiagen). Hanging drops of 1 ml protein at 6mg/ml and 1 ml of precipitant (7-10% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 8 to 10 independent PCR reactions were pooled together and purified using the PCR purification kit (Qiagen). Multiplexed libraries were sequenced on Illumina HiSeq 2500 to obtain 100 bp single-end reads ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were homogenized in 1 ml cell culture medium (see above) and a 5 mm steel bead in a TissueLyser (Qiagen, Hilden, Germany). Fecal samples were vortexed in sterile NaCl and the supernatant was sterile filtered (22µm ...
-
bioRxiv - Immunology 2020Quote: YFP+ Treg cells were sorted from spleen and LN of WT or Usp22fl/flFoxp3YFP-Cre mice (n=5 per group) and total RNA was isolated from 1×106 cells per sample using an RNeasy Mini Kit (Qiagen, Cat# 74104) as previously described47 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and isolated keratinocytes and fibroblasts from the skin and Wound7 (n = 5/each group) (Table 1 and Table S1) by using the miRNeasy Mini kit (Qiagen, Hilden, Germany) and prepared for library construction ...
-
bioRxiv - Cancer Biology 2023Quote: ... we adapted the same conditions used in Dip-C40 and lysed each nucleus in 150 nL of lysis buffer containing 20 mM Tris pH8/20 mM NaCl/25 mM DTT/0.15% Triton X-100/1 mM EDTA/5 µg/mL Qiagen Protease (Qiagen, cat. no. 19157). After dispensing ...
-
bioRxiv - Immunology 2024Quote: Genomic DNA was then isolated from 1-5 million isolated PBMCs using the DNeasy Blood and Tissue kit (Qiagen; Cat. No. 69504) following manufacturer instructions ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...