Labshake search
Citations for Qiagen :
351 - 400 of 3141 citations for 7 Diethylamino 3 nitro 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... and 1-2 µg of RNA was used for the cDNA synthesis (Omniscript RT Kit (Qiagen, 205111)) ...
-
bioRxiv - Immunology 2020Quote: ... in purity mode into 96-well microplates containing 10 μL of 1% 2-mercaptoethanol RLT buffer (Qiagen) and stored at −80°C ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA was isolated from 1-2 mm tail tissue using the DNeasy Blood and Tissue Kit (Qiagen) following the protocol for isolation of DNA from animal tissues and was eluted in 100 µl H2O ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNA oligonucleotides targeting Arf1 and IRSp53 were purchased from Qiagen (Flex-iTube GeneSolution GS375 for Arf1; siArf1#1 Cat. No. SI02654470; siArf1#2 Cat. No. SI00299250; Qiagen Flex-iTube IRSp53 siRNA#1 Cat ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were homogenized (2 x 1 min at 30 Hz) by a TissueLyser (Qiagen, Hilden, Germany) and stored at -20 °C until next step ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mL of culture (0′) was removed and mixed with 2 mL of RNAprotect Bacterial Reagent (QIAGEN), vortexed ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from the gut samples (7-10 guts/sample) using the RNeasy Mini kit (Qiagen) and the on-column DNase I treatment (79254 ...
-
bioRxiv - Biochemistry 2021Quote: ... supernatant was harvested after 7 days of expression and incubated with 300 μL of Ni-NTA resin (Qiagen) at 4°C overnight ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was extracted from seedlings 7 dpg using the RNeasy Plant RNA Extraction kit (Qiagen Ltd., Surrey, UK). RT-PCR was performed using the OneStep RT-PCR kit (Qiagen ...
-
bioRxiv - Bioengineering 2022Quote: Tissue samples at day 0 and 7 were collected from devices and dissociated in the lysis buffer (Qiagen) by agitating with an electronic pestle for 1 min ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Pathology 2020Quote: ... diffracting crystals of P1_102-157 were obtained at 4°C from condition 7 of the Classic kit (Qiagen) containing 0.1 M tri-Sodium citrate pH 5,6 ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... Transfection into C2C12 or MCF-7 cells utilized a lipid-based reagent (Fast-forward protocol, Effectene reagent, Qiagen). As a reference for transfection efficiency ...
-
bioRxiv - Plant Biology 2023Quote: ... The grinding was done using 7 mm stainless steel beads with TissueLyser II bead mill (Qiagen, Hilden, Germany), 2 minutes totally at 25 Hz ...
-
bioRxiv - Immunology 2023Quote: ... cytometry-sorted 7-AAD- CD45+CD11b+F4/80+ cells were lysed in 350µL RLT lysis buffer (Qiagen, 79216). At 4 days post injury ...
-
bioRxiv - Microbiology 2020Quote: ... one well per condition was harvested and processed using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s instructions as noted above ...
-
bioRxiv - Molecular Biology 2019Quote: Real-time one-step reverse transcription quantitative PCR was performed with the QuantiTect Virus Kit (Qiagen, Foster City ...
-
bioRxiv - Neuroscience 2022Quote: Total RNAs (small and large RNAs) were extracted in one fraction with miRNeasy FFPE kit (Qiagen) following manufacturer’s protocol with minor changes ...
-
bioRxiv - Cancer Biology 2020Quote: An RNA probe targeting c-myb was generated using one-step RT-PCR (Qiagen, Manchester, UK) using the following primers c=myb-F 5’-CCAAGTCAGGAAAACGCCACCTCG-3’ and c-myb-R 5’-GCTGTTGTTTAGCGGAGTTGGGCT-3’ and cloned into the dual promoter vector pCRII-TOPO (Life Technologies) ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was isolated from NIH3T3 cells using the FastLane Cell One-Step Buffer Set (Qiagen). The mouse embryo brains at E10.5 were dissected in cold PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... One fifth of the total sample was used to purify RNA using miRNeasy kit (QIAGEN, 217004) and to calculate RNA enrichment ...
-
bioRxiv - Physiology 2022Quote: Approximately one-half of the powdered brain was homogenized in 1ml of QIAzol lysis reagent (Qiagen) and RNA was isolated using the Direct-zol RNA Miniprep Plus Kit (Zymo Research) ...
-
bioRxiv - Biochemistry 2022Quote: ... One microgram of total RNA was reverse transcribed into cDNA using QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.6 µM each XBP1 specific primers and one-step RT-PCR (QIAGEN OneStep RT-PCR, 210212). The PCR products were analysed by 2% agarose gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... One microgram of DNA was bisulfite-treated using the EpiTect 96 Bisulfite Kit (Qiagen GmbH, Germany). 200 ng of bisulfite-treated DNA was analysed using Infinium HumanMethylation 450K BeadChips (Illumina Inc. ...
-
bioRxiv - Genomics 2019Quote: ... DNA was extracted from leaves of one to two plants using a Qiagen MiniPrep Kit (Qiagen). Genotyping of all lines was performed using a custom lentil exome capture assay as described in Ogutcen et al ...
-
bioRxiv - Microbiology 2020Quote: ... CDNA fragments were amplified with strain-specific primers using the one step RT-PCR kit (Qiagen). Sequencing was performed by Macrogen Europe ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total RNA was isolated from one retina per fish using RNeasy Lipid/Tissue Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... One microgram of purified RNA was converted into cDNA using QuantiTect® Reverse Transcription Kit (Qiagen) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... One µg of genomic DNA was used for bisulfite conversion by using EpiTect Bisulfite Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... we extracted DNA from fresh tissue from one individual using the MagAttract HMW DNA Kit (Qiagen). Prior to library preparation ...