Labshake search
Citations for Qiagen :
151 - 200 of 3689 citations for 7 3 2 3 5 dihydroxyphenyl 2 hydroxyethyl amino propyl 3 7 dihydro 1 3 dimethyl 1H purine 2 6 dione monohydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 3 volumes of QIAzol® (Qiagen, Cat. No. 79306) were added to 80 µl of cell extracts ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Genomics 2023Quote: Approximately 3-4 million cells were solubilized with 1 mL QIAzol (Qiagen, 79306) and 0.2 mL chloroform in 5PRIME Phase-Lock Gel heavy tubes (QuantaBio ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 μL water and 5 μL 2x QuantiFast® SYBR® Green PCR Master Mix (Qiagen). Technical duplicates of this reaction mix were then analyzed on a Corbett Rotor-Gene 6000 real-time PCR cycler ...
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... A Locked Nucleic Acid (LNA) probe was used to detect centromere regions (5’-TTGGCTACACCATGAAAGCTT-3’; Qiagen). 20 μL of probe mix (250 nM LNA probe ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 µg pINDUCER20-GFP-AFOS using PolyFect (Qiagen, 301107). Media was collected at 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Solution (System Biosciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Hoko-3 using a Genomic-tip kit (Qiagen, Hilden, Germany). Library preparation was performed using SMRTbell Express Template Prep Kit 2.0 (PacBio ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... then lysed 3 times in a pre-cooled TissueLyser (QIAGEN). Proteins were dissolved in lysis buffer (4% SDS ...
-
bioRxiv - Cell Biology 2019Quote: ... Table 3 in the Rotor Gene Q 2plex cycler (Qiagen).
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 3 mL of Ni-NTA resin (Qiagen) for 1.0 h at 4 °C and then applied to a gravity flow column ...
-
bioRxiv - Molecular Biology 2023Quote: ... were crushed with a tungsten carbide bead (3 mm, Qiagen) on a Retsch MM400 mixer mill for 60 seconds at 30 Hz and DNA was extracted using the DNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... matching a sequence in intron 22 of the HTT gene (5’-TAATACGTAAGTGTCACAA-3’, custom synthesized by Qiagen) was delivered by intracerebroventricular (ICV ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... cells pooled from n = 3 - 5 mice / cohort) was isolated using the RNeasy Plus Mini Kit (Qiagen). Clariom S microarray analysis (Affymetrix ...
-
bioRxiv - Developmental Biology 2020Quote: RNA was extracted from 3 dpf and 6 dpf cdipt mutant zebrafish and their wildtype siblings using RNAeasy (Qiagen). RNA samples were reverse transcribed into cDNA using the iScript cDNA synthesis kit (BioRad) ...
-
bioRxiv - Genetics 2021Quote: Total mRNA was isolated from 2 dpf or 7 dpf zebrafish homogenates using the RNeasy Mini Kit (Qiagen, Cat# 74104) and reverse-transcribed with SuperScript VILO (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg target vector using PolyFect transfection reagent (Qiagen, 301107). Media containing virus was collected both 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Virus Precipitation Solution (System Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 3 min at 50 Hz using a TissueLyser LT (Qiagen) with 1 min incubation on ice in between homogenisations ...
-
bioRxiv - Genetics 2019Quote: ... for 2.5-3 minutes at 30 Hz using TissueLyzer II (Qiagen). Total RNA was extracted from the lysate using NucleoSpin RNA Set for NucleoZOL (Macherey-Nagel ...
-
bioRxiv - Neuroscience 2020Quote: ... siRNAs targeting the 3’UTR of Arhgap11a were purchased (siRNAflex, Qiagen).
-
bioRxiv - Molecular Biology 2019Quote: ... Ligated RNA was purified by adding 3× volume Buffer RLT (Qiagen) and 0.85× volume ethanol ...
-
bioRxiv - Bioengineering 2019Quote: ... size-selected using a 3% agarose EGel EX (Life Technologies, Qiagen), and purified using MinElute Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was incubated with 3 ml Ni-NTA resins (QIAGEN) with gentle agitation at 4 °C for an hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antisense LNA GapmeRs (custom designed, 3’-FAM-labeled, Qiagen, Table S5) were bilaterally microinfused using a 2 μl calibrated micropipette (Hamilton syringes ga 25/70mm/pst3) ...
-
bioRxiv - Bioengineering 2023Quote: ... containing 3 μL 4X Probe PCR Master Mix (250102, Qiagen, USA) (final concentration 1X) ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated with binding buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Neuroscience 2023Quote: ... the tissue was ground using a tissue lyser (Qiagen, 3 min at 300 s-1) in 200 µL 500 mM Tris pH 9 by adding a metal ball (diameter 5 mm) ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... Transcripts were stabilized by mixing 3 mL of cell cultures at the mid-log phase with 6 mL of RNAprotect Bacteria Reagent (Qiagen). Samples were immediately vortexed for 5 sec ...
-
bioRxiv - Immunology 2022Quote: ... A549-ORF7a and A549-ORF7b cells were seeded (3×10E5) in 6-well plates and lysed using RLT buffer for RNA isolation (RNeasy mini kit, Qiagen). Each sample was performed in triplicate ...
-
bioRxiv - Developmental Biology 2020Quote: E9.5 hindbrain spanning rhombomeres 1-6 were dissected from wild type and mutant embryos (n=3) to obtain total mRNA preparations (miRNeasy Micro Kit, Qiagen). Sequencing libraries were prepared following the SMART-Seq v4 Ultra Low Input RNA (TaKaRa ...
-
bioRxiv - Cancer Biology 2021Quote: ... The supernatant was loaded over 3 ml of Ni-NTA beads (Qiagen) equilibrated in lysis buffer ...
-
bioRxiv - Immunology 2019Quote: ... and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH; all primers from Qiagen).
-
bioRxiv - Evolutionary Biology 2019Quote: ... An additional bead-beating step using 3 mm carbide beads (Qiagen, UK) in a Qiagen tissue lyzer (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against 3’UTR sequence of mouse Alr were purchased from Qiagen. siRNAs were transfected into HEK293 or MEF using Dharmafect 1 Transfection Reagent (Dharmacon) ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... the 3’ adaptor sequence (AACTGTAGGCACCATCAAT) was trimmed based on vendor’s recommendation (Qiagen). After adaptor trimming ...
-
bioRxiv - Microbiology 2023Quote: ... then resuspended in 3 mL of RNAprotect for bacterial cells (Qiagen, #76506). Planktonic cultures were similarly pelleted and resuspended in RNAprotect ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then applied to a 3 mL Ni-NTA (Qiagen) column ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated overnight with 3 ml Ni-NTA beads (Qiagen) preequilibrated with the extraction buffer ...
-
bioRxiv - Immunology 2023Quote: Tissue was homogenized by using sterile 3-mm tungsten carbide beads (QIAGEN) in a TissueLyser II (QIAGEN ...
-
bioRxiv - Developmental Biology 2023Quote: ... tailbuds were individually lysed in 3 μL of RLT + BME (Qiagen RNeasy) and stored in separate PCR tubes at –80 °C to await genotyping of heads (for rad21-/- and rad21+/-) ...