Labshake search
Citations for Qiagen :
251 - 300 of 1533 citations for 6H THIENO 2 3 B THIOPYRAN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Bioengineering 2021Quote: ... the mEV solution was incubated with 100 µl of precipitation buffer B from the Qiagen miRCURY Exosome Isolation Kit (Qiagen, Germantown, MD) overnight (∼12 hours ...
-
bioRxiv - Immunology 2020Quote: RNA from B1a B cells was reverse transcribed and amplified using a Qiagen OneStep RT-PCR kit (Qiagen Inc., Valencia, CA, USA) and iRepertoire® mouse BCR heavy chain (MBHI ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from different parts of the seedling (Figure1 a) and the peel of fruit (Figure1 b) using RNeasy Plant Mini kit (Qiagen, Hilden, Germany). Total amounts and integrity of RNA were assessed using the RNANano 6000Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies ...
-
bioRxiv - Genomics 2024Quote: ... the Qiagen RNeasy Mini Kit was used according to Qiagen RNA Protect Reagent Handbook Protocols 4 and 7 with Appendix B on-column DNase digestion (Qiagen, Hilden, Germany). The RNA was assessed with UV-Vis spectrophotometry (Denovix DS-11 ...
-
bioRxiv - Cell Biology 2024Quote: ... tissue was snap frozen in liquid nitrogen and pulverized with a microdismembrator S (B. Braun Biotech, Melsungen, Germany) before total RNA isolation by means of the Lipid Tissue Mini Kit (Qiagen, Hilden, Germany). Isolated cells were lysed in RLT buffer ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... The supernatant was loaded over 3 ml of Ni-NTA beads (Qiagen) equilibrated in lysis buffer ...
-
bioRxiv - Immunology 2019Quote: ... and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH; all primers from Qiagen).
-
bioRxiv - Evolutionary Biology 2019Quote: ... An additional bead-beating step using 3 mm carbide beads (Qiagen, UK) in a Qiagen tissue lyzer (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA sequence (5’-GAGUAGAACUAGAAUGUGA-3’) targeting Hec1 was synthesized by Qiagen. The ON-TARGETplus SMARTpool siRNA sequences (5’-GAACGAGUAACCACAAUUA-3’) ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against 3’UTR sequence of mouse Alr were purchased from Qiagen. siRNAs were transfected into HEK293 or MEF using Dharmafect 1 Transfection Reagent (Dharmacon) ...
-
bioRxiv - Molecular Biology 2019Quote: ... A 1:3 mixture of a QuantiFast SYBR Green PCR Kit (Qiagen) and a FastStart SYBR Green Master (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen), pools of siRNAs targeting the TP53 sequence 5’-GAAAUUUGCGUGUGGAGUA-3’ ...
-
bioRxiv - Genomics 2021Quote: ... The scramble-miR miRCURY LNA Detection probe (5’-GTGTAACACGTCTATACGCCCA-3’, YD00699004, QIAGEN) was used as a negative control ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... The 3’ and 5’ – DIG labeled miRCURY LNA miRNA Detection probes (Qiagen, negative control Scramble-miR cat ...
-
bioRxiv - Genetics 2020Quote: ... the 3’ adaptor sequence (AACTGTAGGCACCATCAAT) was trimmed based on vendor’s recommendation (Qiagen). After adaptor trimming ...
-
bioRxiv - Microbiology 2023Quote: ... then resuspended in 3 mL of RNAprotect for bacterial cells (Qiagen, #76506). Planktonic cultures were similarly pelleted and resuspended in RNAprotect ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then applied to a 3 mL Ni-NTA (Qiagen) column ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated overnight with 3 ml Ni-NTA beads (Qiagen) preequilibrated with the extraction buffer ...
-
bioRxiv - Immunology 2023Quote: Tissue was homogenized by using sterile 3-mm tungsten carbide beads (QIAGEN) in a TissueLyser II (QIAGEN ...
-
bioRxiv - Developmental Biology 2023Quote: ... tailbuds were individually lysed in 3 μL of RLT + BME (Qiagen RNeasy) and stored in separate PCR tubes at –80 °C to await genotyping of heads (for rad21-/- and rad21+/-) ...
-
bioRxiv - Cell Biology 2023Quote: ... mRNA was isolated from 3 dpf TL larvae (RNeasy, Qiagen; RNAlater, Invitrogen), and AffinityScript QPCR cDNA Synthesis Kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... the tissue samples were homogenised using 3 mm stainless steel beads (Qiagen) and a TissueLyser II (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: Colon tissue fragments (3 mm, proximal colon) were stored in RNAlater (Qiagen) overnight at 4c ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or miR-200b/200c on the ZC3H11A 3’UTR were obtained from Qiagen. TSBs were resuspended in ddH2O to prepare a 50 µM solution ...
-
bioRxiv - Biochemistry 2021Quote: ... The sample was then loaded onto 3 ml of Ni-NTA resin (Qiagen) by gravity at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... n=3) using the RNeasy Mini kit (Cat. No. 74104, QIAGEN, Hilden, German) and manufacturer’s protocol ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...
-
bioRxiv - Microbiology 2020Quote: ... by bead beating (50 Hz for 3 five-minute cycles, TissueLyzer II (Qiagen) with 0.1 mm silica beads) ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated from 3 dpf larvae with the RNeasy mini kit (QIAGEN). A cDNA library was generated from the 3 dpf RNA using the high-capacity cDNA reverse transcription kit (ThermoFisher) ...
-
bioRxiv - Neuroscience 2020Quote: NALCN-siRNA and control-siRNA with modification of 3’-AlexaFluor488 (QIAGEN, Maryland, USA) were dissolved in RNase-free water (NALCN-siRNA ...
-
bioRxiv - Cancer Biology 2020Quote: DNA from ~3×106 cells was extracted with DNeasy Blood&Tissue kit (Qiagen). For SUM159PT/MDA-MB-231 hybrids and MCFDCIS/SUM159PT from lung metastasis CytoSNP-12 v2.1 BeadChip array from Illumina was used and data analyzed with GenomeStudio 2.0 software (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... and 12-days post infection (3 samples/group) using the RNeasy Kit (Qiagen). Samples were processed at the Baylor College of Medicine Genomic and RNA Expression Profiling Core (Houston ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were cleaned of enzymes by adding 3× volume Buffer RLT (Qiagen, 79216) and 1× volume ethanol ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected with pNL4-3 vectors using Attractene Transfection Reagent (QIAGEN, Germany). After 8 hr ...