Labshake search
Citations for Qiagen :
351 - 400 of 1461 citations for 6H Pyrrolo 3 2 e benzothiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
bioRxiv - Genetics 2021Quote: RNA was extracted from an aliquot of 3 × 106 cells using the RNeasy Plus Kit (Qiagen). cDNA was synthesized from extracted RNA using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... Media and osteoblasts were harvested 3 days later and EVs were collected using Exoeasy kit (Qiagen). Total RNA was extracted using miRNeasy micro (Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: ... RNA from 3 x 106 HMC-1.2 cells was extracted using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-month-old zebrafish (1 fish/sample) using the RNeasy Mini Kit (Cat. No. 74104; Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Cell Biology 2022Quote: ... A Locked Nucleic Acid (LNA) probe was used to detect centromere regions (5’-TTGGCTACACCATGAAAGCTT-3’; Qiagen). 20 μL of probe mix (250 nM LNA probe ...
-
bioRxiv - Microbiology 2022Quote: ... 3 mL samples were added to tubes containing 6 mL RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and vortexed ...
-
bioRxiv - Genetics 2022Quote: ... 3 min in 37°C shaker) and processed with DNeasy Blood and Tissue Kit (QIAGEN #69504). Two hundred ng of genomic DNA was used as input in the DamID protocol that included an improved pool of AdR primers as described (de la Cruz Ruiz et al ...
-
bioRxiv - Biochemistry 2023Quote: The total RNA was extracted from 3 × 106 HEK293T cells using the RNeasy Mini Kit (QIAGEN). RNA served as a template for subsequent reverse transcription into cDNA by iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... whole eyes were homogenized in PBS using a TissueLyser II (Qiagen, 30 Hz for 3 minutes), and homogenates were serially diluted and streaked on LB plates for quantification of colony forming units (CFU ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were mechanically disrupted for 2x 3 min at 30 Hz (TissueLyser II, Qiagen, Hilden, Germany). This was followed by adding 5 μl of proteinase K (20 mg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... and the supernatant was added to 3 ml of Ni-nitrilotriacetic acid (NTA) superflow resin (Qiagen) and the mixture was applied onto a gravity drip column ...
-
bioRxiv - Cancer Biology 2024Quote: ... and total RNA was extracted using the RNAeasy Mini kit (Qiagen, 74104; n = 3 independent experiments). Prior to library construction ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Genomics 2020Quote: ... The primer used in the 3’ RACE assay was designed using CLC Genomic Workbench (ver. 10.1.1, Qiagen) near the highest CAGE-Seq signal in the determined TSS region ...
-
bioRxiv - Molecular Biology 2019Quote: Body tissue of medaka at 3 dph was minced and then processed with a RNeasy Minikit (Qiagen) for extraction of total RNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 mL were collected and used for plasmid extraction using a QI-Aprep Spin Miniprep kit (QIAGEN). Extracted plasmids were eluted in 30 μL of elution buffer and stored at −20 °C until use.
-
bioRxiv - Cancer Biology 2021Quote: Whole RNA (1-3 μg total per 10 μL volume) was isolated using RNAeasy mini kit (QIAGEN) or TRIzol (Life Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... matching a sequence in intron 22 of the HTT gene (5’-TAATACGTAAGTGTCACAA-3’, custom synthesized by Qiagen) was delivered by intracerebroventricular (ICV ...
-
bioRxiv - Bioengineering 2022Quote: Total RNA content was extracted from 3 biological replicates using RNeasy® Plus Mini kit (#74134, Qiagen) following manufacture’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Pelleted cells were resuspended in 1 ml of Na2CO3 buffer containing 3 µg/ml RNase A (Qiagen) and incubated at 50°C for at least 4 h ...
-
bioRxiv - Microbiology 2022Quote: Extraction method 3 used a modified version of the Qiagen QIAamp Mini DNA kit (Qiagen, Venlo, Netherlands). Following initial pelleting ...
-
bioRxiv - Microbiology 2022Quote: ... 1ml of PBS-AB was added to each sample along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized for 10 min and then centrifuged at 15,000 g for 10 min ...
-
bioRxiv - Immunology 2021Quote: ... The samples (N=3) were collected immediately and soaked in 10 volumes of RNAlater (Qiagen, Hilden, Germany), for sequencing using Illumina (New England Biolabs) ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then washed 3 x with ice-cold 1x PBS and lysed in RLT buffer (Qiagen) with 1/100 β-mercaptoethanol (Sigma ...
-
Surveying the landscape of tRNA modifications by combining tRNA sequencing and RNA mass spectrometrybioRxiv - Biochemistry 2019Quote: 400-1000 ng isolated tRNAs were digested in 3 μl aliquot with 20 ng RNase A (QIAGEN) in 10 mM NH4OAc pH 7 or 20 unit RNase T1 in 10 mM NH4OAc pH 5.3 at 37 °C for 1 hr ...
-
bioRxiv - Genetics 2021Quote: Genomic DNA was extracted from an aliquot of 3 × 106 cells using the Gentra Purgene Kit (Qiagen). The genomic region surrounding the CRISPR/Cas9 target site (741 bp ...
-
bioRxiv - Bioengineering 2022Quote: ... messenger RNA (mRNA) combined from at least 3 gels were isolated with an RNeasy Mini Kit (Qiagen) and then reverse transcribed into complementary DNA (cDNA ...