Labshake search
Citations for Qiagen :
351 - 400 of 2138 citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The lysates from the EmulsiFlex B-15 homogenizer were added to Ni-NTA agarose (Qiagen) and incubated on the nutator at 4 °C for 1 h ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Immunology 2022Quote: Sorted B cells were lysed for RNA extraction by the RNeasy Micro Kit (Qiagen, 74004). Primers used for reverse transcription and library amplification are provided in Table S2 ...
-
bioRxiv - Physiology 2022Quote: ... The washed pellet was resuspended in Buffer B with 300 μg/ml DNase I (QIAGEN) and 5 mM MgCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells from the inserts were lysed and collected into RLT buffer containing B-mercaptoethnaol (QIAGEN) for downstream molecular analyses by RT-qPCR.
-
bioRxiv - Plant Biology 2024Quote: ... CcAP1 and CcFULLike-A and CcFULLike-B with CLC Genomics Workbench v21.0.3 (QIAGEN, Aarhus, Denmark) (Supplementary Table S5) ...
-
bioRxiv - Bioengineering 2024Quote: Sorted B cells were lysed for RNA extraction by the RNeasy Micro Kit (Qiagen, 74004). First-strand cDNA synthesis was performed on 8 μl of total RNA using 5 pmol of IgM and IgG specific primers in a 20 μl total reaction with SuperScript III (Thermo Fisher ...
-
bioRxiv - Genetics 2021Quote: ... 128° 11’ 17.2” E) and the genomic DNA was extracted from the whole bodies using DNeasy® Blood & Tissue kit (Qiagen, GmbH, Hilden, Germany). Illumina libraries for whole bodies were constructed using the TruSeq Nano Sample Prep kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5-plex (Qiagen, Germany), the QIAcuity One-Step Viral RT-PCR Kit (Cat No ...
-
bioRxiv - Cell Biology 2020Quote: ... + 5 μM TSO (Qiagen). Amplification of cDNA (22 amplification cycles ...
-
bioRxiv - Molecular Biology 2021Quote: Ni-NTA agarose beads (Qiagen 70666-3)
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Physiology 2020Quote: ... existing media was removed and the resulting myotubes received either 750 µl of fresh DM alone or 750 µl DM containing 9 µl HiPerFectTransfection™ (Qiagen, UK) and 20 nmol Flexitube GeneSolutions™ (siUBR5 ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were co-transfected with the 9 × GCCG-reporter construct and the renilla-luciferase control vector using SuperFect (Qiagen, Valencia, CA) for 24 h ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was extracted and purified as described in [9] using the Quick-RNA MiniPrep Kit (Zymoresearch, Irvine, CA, USA) and RNeasy MinElute Cleanup Kit (QIAGEN, Hilden, Germany). Per sample at least 150 ng of high-quality RNA were obtained ...
-
bioRxiv - Microbiology 2019Quote: ... and the variants (single nucleotide changes and small deletion up to 50 nucleotides) were detected with the Fixed Ploidy Variant Detection tool in CLC Genomics Workbench version 9 (CLC, Bio-QIAGEN, Aarhus, Denmark). Variants falling in PE/PPE family genes were excluded from the analysis.
-
bioRxiv - Zoology 2019Quote: DNA was extracted from one individual pre-pupa that was pulled out from a cocoon sample (voucher # USDA-BRL 181221-03_G21; Fig 1-9 to 1-13) using the DNeasy Blood & Tissue Kit (Qiagen Inc., Valencia, CA), as per manufacturers protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... and unfragmented genomic DNA (A260/A280 ≥ 1.8 and A260/A230 ≥ 1.9) was extracted from whole blood obtained from the subject and his parents using the Puregene Blood kit from Qiagen (Valencia, CA). Whole exome sequencing was performed using the service provided by Beijing Genomics Institute (Cambridge ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... For SAS-6 knock down experiments siNegative control (siNegative, Qiagen, 1027310) and siSAS-6 (siSAS6 on-TARGET smart pool ...
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from fresh or cultured primary B cells using the RNeasy Minikit (Qiagen) or Trizol reagent (Ambion ...
-
bioRxiv - Immunology 2021Quote: ... RNA was isolated from the differentially stimulated B cells using the RNeasy Plus Micro Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was prepared from human or mouse B cells using QIAmp DNA Mini Kit (Qiagen), or from paraffin-embedded human IgD or IgA myeloma tissue sections (obtained from the University of Arkansas for Medical Science ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was extracted from B cell populations sorted in duplicates (Gentra Puregene Core Kit, Qiagen). Rearranged IGHV genes were sequenced by massive parallel sequencing ...
-
bioRxiv - Immunology 2021Quote: ... RNA was isolated from sorted B cells for each patient using the RNeasy Micro kit (Qiagen) with on-column DNase digestion ...
-
bioRxiv - Microbiology 2023Quote: ... gDNA was extracted using an isopropanol-ethanol purification kit (Puregene Yeast/Bact. Kit B from Qiagen) and following the manufacturer’s protocol including a 60-minute RNase A treatment ...
-
bioRxiv - Cell Biology 2021Quote: ... 5×10^5 EpCAM+ve cells were lysed in 350μL RTL Buffer (Qiagen) containing 143mM β-Mercaptoethanol (aided by cell searing via passage ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2020Quote: Data to derive different biological clocks was available for different subsamples and all based on a fasting blood draw from participants in the morning between 8:30 and 9:30 after which samples were stored in a −80°C freezer or – for RNA - transferred into PAXgene tubes (Qiagen, Valencia, California, USA) and stored at −20°C ...
-
bioRxiv - Genetics 2022Quote: ... and conventional extraction methods (n = 9) using a lysis buffer and purified using silica columns (Qiagen DNeasy Plant Kit Qiagen Inc, Hilden, Germany). All lysates were analyzed with a QubitTM 4 Fluorometer (ThermoFisher ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...