Labshake search
Citations for Qiagen :
251 - 300 of 2341 citations for 6H Pyrazolo 3 4 g benzothiazole 2 methyl 8CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Amplification was performed using REPLI-g single kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: We used the REPLI-g mitochondrial DNA kit (Qiagen) to perform WMGA according to the manufacturer’s instruction with the following modifications ...
-
bioRxiv - Genetics 2020Quote: ... or REPLI-g single cell kit (Qiagen Cat #150345) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Genetics 2019Quote: ... DNA was isolated from 1 g of unexpanded leaves with CTAB method and purified with Genomic Tip 20/G (Qiagen K. K. Tokyo). The extracted DNA was sheared into 20 kb fragments using g-TUBE (Covaris ...
-
bioRxiv - Cell Biology 2021Quote: ... si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’, Qiagen), si-uS19 (5’-UCACCUACAAGCCCGUAAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’, Qiagen), si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’ ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tissues were weighed and homogenized in 4 volumes of water (4 µL of water/mg tissue, 4°C) using a bead beater (TissueLyser II, QIAGEN; Germantown, MD). Aqueous homogenates were profiled using four complimentary liquid chromatography tandem mass spectrometry (LC-MS ...
-
bioRxiv - Systems Biology 2020Quote: ... was prepared by centrifuging a cell culture at 5525xg for 2 minutes at 4°C then resuspending cells in 1mL of PBS-RNAprotect (333 μL RNAprotect Bacteria Reagent [76506, Qiagen, Hilden, Germany], 666 μL PBS). For immediate RNA stabilization by RNAprotect (Fig ...
-
bioRxiv - Zoology 2021Quote: ... the REPLI-g Single Cell Kit (QIAGEN®, Hilden, Germany) was used ...
-
bioRxiv - Biochemistry 2020Quote: ... 15 g of semi-dry Ni-NTA resin (Qiagen 30450) was weighed out into each of three conical tubes ...
-
bioRxiv - Zoology 2019Quote: ... using REPLI-g Single Cell Kit (QIAGEN®, Hilden, Germany). The cells of KKR18_Esm strain were washed in distilled water for three times and the last time in PBS buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Samples (0.5 g) were mechanically disrupted using a TissueLyser (Qiagen) for 2 × 30 seconds at 30 Hz ...
-
bioRxiv - Genomics 2023Quote: ... using QIAGEN Genomic tip 500/G (QIAGEN Cat. No. 10262). DNA quality was measured on 1% agarose gel and with a NanoDrop spectrophotometer ...
-
bioRxiv - Neuroscience 2023Quote: DNA isolation and quantification was performed as previously described43,44,68 using a high molecular weight genomic DNA purification kit according to the manufacturer’s protocol (QIAGEN Genomic tip either 20/G or 100/G) and Quant-iT Picogreen dsDNA quantification ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Molecular Biology 2021Quote: Ni-NTA agarose beads (Qiagen 70666-3)
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was finally extracted using Genomic Tip G-500 columns (Qiagen) and cleaned using the PowerClean DNA Clean-Up kit (MoBio Labs) ...
-
bioRxiv - Genomics 2021Quote: ... 56 μL of amplification mix (REPLI-g Single Cell Kit, Qiagen) that contained alpha-thio-ddNTPs (Trilink Bio Technologies ...
-
bioRxiv - Genetics 2019Quote: ... and DNA was extracted using Genomic Tip G-500 columns (Qiagen) and cleaned using the PowerClean DNA Clean-Up kit (MoBio Labs) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... whole genome amplification was performed using REPLI-g Mini kit (Qiagen) due to the low concentrations of gDNA ...
-
bioRxiv - Genomics 2021Quote: ... HMW gDNA was captured by magnetic particles (Qiagen MagAttract Suspension G), and then the magnetic particles with HMW gDNA was washed in wash buffer and eluted in EB Buffer (10 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2020Quote: ... A nonmethylated control was prepared using REPLI-g Mini kit (Qiagen).
-
bioRxiv - Microbiology 2022Quote: ... Control unmethylated DNA was prepared using a Repli-g kit (QIAGEN). C ...
-
bioRxiv - Neuroscience 2022Quote: ... using Qiagen Genomic-tip 100/G HMW Kit (Qiagen, Hilden, Germany), according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: We extracted DNA using the Qiagen Genomic Tip 20/G (Qiagen) and followed the manufacturer’s protocol “Preparation Gram-negative and some Gram-positive Bacterial Samples” ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... using the QIAGEN Genomic-tip 20/G standard protocol (Qiagen, UK). All samples were sequenced at the University of Liverpool from Illumina TruSeq Nano libraries with 350bp inserts using 125bp paired-end reads on an Illumina HiSeq2500 platform ...
-
bioRxiv - Microbiology 2019Quote: ... pylori-infected mice using a genomic-tip 20/G kit (Qiagen, catalog no ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was purified using Qiagen Genomic-tip 20/G (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... followed by DNA extraction using Genomic Tip G-500 columns (Qiagen) and cleaning with the PowerClean DNA Clean-Up kit (MoBio Labs) ...
-
Ultra-high-throughput microbial single-cell whole genome sequencing for genome-resolved metagenomicsbioRxiv - Microbiology 2022Quote: ... 20 μL REPLI-g sc DNA Polymerase (Qiagen, catalog no. 150345), 30 μL 10 x Eva green (biotium ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... genomic DNA was directly amplified using the Repli-G kit (Qiagen), and then sequenced with Illumina HiSeq from TruSeq gDNA libraries by GenomeQuebec ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.5 g roots using RNeasy Plant Mini Kit (QIAGEN, Canada). Extracted RNA was treated with DNAse (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used a Repli-G whole- genome amplification kit (Qiagen, Inc.) to increase the amount of DNA prior to library preparation ...
-
bioRxiv - Microbiology 2024Quote: Plasmid DNA was amplified using REPLI-g® Midi Kit (QIAGEN), according to the manufactureŕs instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...