Labshake search
Citations for Qiagen :
301 - 350 of 3178 citations for 6H Imidazo 4 5 1 ij quinolin 6 one 4 5 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... Lysates were spun for a further 20 min at 40,000 g at 4 °C and resulting supernatants were incubated 1 hour with Ni2+-nitrilotriacetate (NTA) agarose beads (QIAGEN) at 4 °C on rotating wheel ...
-
bioRxiv - Physiology 2021Quote: ... 10-50 mg tissue was homogenized (1 mM EDTA and 4 mM sodiummetabisulfite, pH 7.4) using a TissueLyser II (Qiagen). Samples where adjusted to the same weight/volume percentage by adding a volume of homogenization buffer and the NA content was measured by ELISA (BA E-5200 ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 1 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture for 2 h rotating at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were clarified by centrifugation for 1 h at 4°C at 10,000 rcf before being subjected to Ni-NTA (Qiagen) affinity purification following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Systems Biology 2020Quote: ... the MoBioPowersoil 96 kit (now Qiagen Cat No./Id: 12955-4) was used with minor modifications ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL of Buffer D2 (REPLI-g Single Cell Kit, Qiagen) and 1 μL of 500 μM exonuclease-resistant random primer were then added to the lysed cells to denature the DNA prior to vortexing ...
-
bioRxiv - Cell Biology 2022Quote: ... and TBT (4 biological replicates per condition) with RNeasy columns (Qiagen), followed by oligo-dT selection ...
-
bioRxiv - Systems Biology 2023Quote: ... or 4 pmol total negative control siRNA (Allstars negative control, Qiagen), were transfected using the Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated on 4-12% Bis-Tris gels (Novex, Qiagen) using MOPS running buffer (Novex ...
-
bioRxiv - Microbiology 2021Quote: ... prior to the addition of proteinase K and 5 μl of 100 mg ml−1 RNase A (Qiagen). The DNA concentration was determined using a Qubit fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... a 19-mer SPRY2 target sequence (5′-AACACCAATGAGTACACAGAG-3) (QIAGEN) was used and for the control a 19-mer NSi control sequence (QIAGEN ...
-
bioRxiv - Cell Biology 2020Quote: ... For Astrin siRNA oligo #367 (5′-TCCCGACAAC TCACAGAGAAA -3′)(Qiagen) was used as described (Thein et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Wells contained 5 μl/well TCL-buffer (QIAGEN, cat. 1031576) with 1% 2-Mercaptoethanol ...
-
bioRxiv - Microbiology 2019Quote: ... each along with 5 mm diameter stainless steel beads (QIAGEN). The TissueLyser II (QIAGEN ...
-
bioRxiv - Molecular Biology 2019Quote: ... using mechanical disruption with 5 mm stainless steel beads (Qiagen) on a Tissue Lyser II (Qiagen) ...
-
bioRxiv - Plant Biology 2020Quote: ... 0.12 units of Taq DNA polymerase (Qiagen, 5 units/μL) and 14.44 μL of ultra-pure water ...
-
bioRxiv - Microbiology 2021Quote: ... was added to a column (Qiagen, 5 mL polypropylene column), equilibrated with lysis buffer ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... bead mill with 5-mm stainless-steel beads (Qiagen, #69989). Homogenates were centrifuged at 16,000 g for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... and 5 mm stainless steel beads (Qiagen, Cat No. 69989) and briefly centrifuged ...
-
bioRxiv - Microbiology 2020Quote: ... 5) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) with modifications ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... bead mill with 5-mm stainless-steel beads (Qiagen, #69989). Insoluble debris was pelleted by centrifugation ...
-
bioRxiv - Microbiology 2023Quote: ... with two 5-minute cycles on a TissueLyser II (Qiagen) separated by a 5-minute incubation on ice ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mL erythrocyte lysis buffer (EL buffer, Qiagen, Hilden, Germany) was added and PMNs were centrifuged ...
-
bioRxiv - Cancer Biology 2024Quote: ... along with a pre-chilled 5-mm steel bead (QIAGEN). All samples were then placed in pre-chilled cassettes for the Tissue Lyser II and pulverized for at 30 1/s for three 1-minute oscillations ...
-
bioRxiv - Plant Biology 2021Quote: ... The translation mixture was gently agitated in a microtube for 1 h at 4°C with a fivefold volume of Ni-NTA agarose (Qiagen) that had been equilibrated with a solution containing 50 mM Tris-HCl (pH 7.5 ...
-
bioRxiv - Genetics 2022Quote: ... The tissue powder was then transferred to a 1.5 mL centrifuge tube where 400 μL of 1% PVP-40 Buffer AP1 solution and 4 μL of RNase A were added (Qiagen DNeasy Plant Kit Qiagen Inc ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tumors were homogenized with QIAGEN Tissue Lyser (4 × 1’, 30 Hz) using a 5mm stainless steel bead (Qiagen, Hombrechtikon, Switzerland) and sonicated for 20s ...
-
bioRxiv - Microbiology 2019Quote: ... from the ME phase and ES phase (1 ml) were added to 4 ml and 2 ml of RNAprotect Bacteria Reagent (Qiagen), respectively ...
-
bioRxiv - Plant Biology 2020Quote: ... After vortexing the samples for 10 s and lysing the tissue with 4 mm glass beads for 1 min at 30 Hz in the TissueLyser II (Qiagen), 400 μL of Tris-HCl pH:7.5 were added and the samples were again mixed for 1 min in the TissueLyser ...
-
bioRxiv - Immunology 2020Quote: RNA was extracted from isolated neutrophils after the 1 and 4 hour EC challenges as well untreated controls using the miRNeasy Micro kit from Qiagen and libraries were generated using KAPA PolyA enrichment mRNA library prep ...
-
bioRxiv - Genomics 2021Quote: ... To eliminate lipids supernatants were applied to a RNeasy column and centrifuged at 10,000 rpm and 4 °C for 1 min (Qiagen, 74104). The flow through was collected and protein concentrations were assessed using the Bradford assay ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.4 mg/mL Proteinase K (55°C for 1 hour) before being purified using the QIAquick PCR purification kit (QIAGEN). qPCR was performed on the Rotor-Gene 3000 (Corbett Life Science ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting mixture was rotated at 4 °C for 60 min and then poured into a 1 mL polypropylene column (Qiagen). The resin was washed three times with 5 mL lysis/wash buffer and eluted in 0.25 mL fractions with Ni-NTA elution buffer (composition same as lysis/wash buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... previously coated with the anti-B55δ antibody (1 hour incubation at 4°C, followed by extensive washes) and Nickel beads (Qiagen) coated with 400 μg of 6XHIS-S67thio-S109A-XeARPP19 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The cell pellet was removed after centrifugation (16000 rpm, 4 °C, 1 h) and supernatant was loaded into a Ni-NTA agarose column (Qiagen). Protein was eluted in an elution buffer (50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2020Quote: ... After 14 h binding to 4 mL Ni-NTA agarose beads (Qiagen), the beads were first washed with 15 mL Ni-NTA binding buffer and then with 15 mL Ni-NTA wash buffer (1 M NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 µL of DNA) and run in Rotor-Gene Q machine (QIAGEN). Primer sequences are listed in the table S2 ...
-
bioRxiv - Bioengineering 2021Quote: ... Sample supernatants were incubated with 4 mL of Ni-NTA Agarose (Qiagen) for >1 hour at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... and pooled using the UltraClean 96 PCR Cleanup kit (Qiagen 12596-4) and Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen Q33120) ...
-
bioRxiv - Microbiology 2022Quote: ... and pooled using the UltraClean 96 PCR Cleanup kit (Qiagen 12596-4) and Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen Q33120) ...
-
bioRxiv - Genomics 2022Quote: ... and 4 µl of 100 mg/ml RNase A (QIAGEN, cat# 19101) were added to the homogenate ...
-
bioRxiv - Biochemistry 2020Quote: ... Crystallization screening was performed at 4°C with JCSG core I (Qiagen) using the sitting drop vapor diffusion method ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μl of DNA) and run in Rotor-Gene Q machine (Qiagen). Primer sequences are listed in the Table 2 ...
-
bioRxiv - Microbiology 2021Quote: ... Removed culture was mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) for stabilization and incubated for 5 min at room temperature before centrifugation at 4000 rpm for 10 min ...