Labshake search
Citations for Qiagen :
151 - 200 of 3274 citations for 6H Furo 3 2 d 1 3 dioxin 6 one 4a ethoxytetrahydro 2 2 dimethyl 4aR 7aR 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using the QIAseq SARS-CoV-2 Primer Panel V2 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using QIAseq SARS-CoV-2 Primer Panel V1 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from d2 (n. 2 biological replicates) and d4 (n. 2 biological replicates) cells with QIAzol lysis reagent (Qiagen #79306), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from 1-2 million cells using RNeasy Mini Kit (QIAGEN) using QIAcube (QIAGEN) ...
-
bioRxiv - Paleontology 2019Quote: ... plasmid minipreps were purified with a QIAprep Miniprep Kit (Qiagen, chimpanzee 1 and 2), and RBC Miniprep Kit (YPD100 ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mL of each culture was added to 2 mL RNAprotect Bacteria Reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... Following a 2-hour RNase A treatment (Qiagen, 100 mg/ml, 1:1,000 dilution) at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Transient transfections were carried out using just subconfluent cultures in 35 mm plates or in wells of a 6-well plate using DNA in the range of 0.3-2 µg/culture and the Polyfect reagent (Qiagen, Germantown, MD) and the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... in vitro derived Foxp3+ cells were harvested on day 2 and day 6 into Trizol and total RNA was isolated with miRNeasy Micro Kits (QIAGEN 217084) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... Ganglia in 1 mL of TRIzol reagent were homogenized using a TissueLyzer II bead mill (one 5 mm stainless steel bead per tube, 30 s-1 frequency for 3 minutes; Qiagen Inc. Hilden, Germany). The homogenates were incubated with 200 µL chloroform and centrifuged for 15 minutes at 12000 x g to isolate the protein-containing organic phase ...
-
bioRxiv - Cancer Biology 2023Quote: ... Deproteination of the D-2-HG quantification aliquot was achieved using 3.0 mL of Proteinase K (Qiagen, Catalog #19131, Hildren, Germany) per 100.0 mL of cell lysis solution ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Microbiology 2022Quote: ... 3 mL samples were added to tubes containing 6 mL RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and vortexed ...
-
bioRxiv - Genetics 2020Quote: ... approximately 30 seeds per genotype were placed in a 2 mL Eppendorf Safe Lock tube along with one stainless steel bead (Qiagen Cat. No. 69989), frozen in liquid nitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: Liver tissue was homogenized in chloroform/methanol (2:1, 1 mL) using TissueLyser (Qiagen Ltd., Manchester, UK). Deionized water (400 uL ...
-
bioRxiv - Immunology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and ground for 2 min using a TissueLyser (Qiagen). DNA extraction was performed using a 96-well column based kit ...
-
bioRxiv - Genomics 2019Quote: ... and BS (2) EpiTect Bisulfite Kit (QIAGEN, Hilden, Germany) respectively according to the manufacturers’ recommendations ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM PMSF) on a Ni-NTA resin (Qiagen). Bound proteins were washed (50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) containing 0.1% Tween20 (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... the 2 proteases of proteinase K (Qiagen, Hilden, Germany) and dispaseII (Sigma-Aldrich ...
-
bioRxiv - Genomics 2022Quote: ... 2 μl of 100 mg/mL RNase A (Qiagen) was added and the tubes were incubated at 37°C for 15 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) are added to one volume of bacterial culture ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µl Qiagen CL buffer (10x; Qiagen, Hilden, Germany), 0.4 µl MgCl2 (25 mM ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... One million cells per well were seeded in 6 well plates in 2 mL growth medium the day before transfection and transfected with PolyFect (Qiagen, Düsseldorf, DE) using the manufacturers protocol (changing the medium to growth medium without hygromycin B and puromycin prior to transfection) ...
-
bioRxiv - Genomics 2020Quote: Total RNA was extracted from 1–2 million cells using the AllPrep Mini kit (QIAGEN) according to the manufacturer’s instructions and 1 μg of total RNA was used to prepare each RNA-seq library ...
-
bioRxiv - Microbiology 2021Quote: ... and 1% penicillin–streptomycin) at 300 Hz for 2 min using a Tissuelyser II (Qiagen) and centrifuged to clarify the supernatant ...
-
bioRxiv - Microbiology 2022Quote: ... and 1% penicillin–streptomycin) at 300 Hz for 2 min using a Tissuelyser II (Qiagen) and were then centrifuged to clarify the supernatant ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mL of sample culture was immediately transferred into 2 mL RNA protect bacteria (QIAGEN) and vortexed ...
-
bioRxiv - Microbiology 2023Quote: ... we placed filters in 2 mL tubes with beads and 1 mL TE buffer (Qiagen plasmid isolation kit ...
-
bioRxiv - Biochemistry 2023Quote: Total RNA was extracted from 1 – 2 x 108 cells using the RNeasy kit (Qiagen). DNA was removed using Turbo DNase (Applichem ...
-
bioRxiv - Neuroscience 2021Quote: ... and 6h time points using the RNeasy Plus kit (QIAGEN). The RNAs were used as a template for cDNA synthesis followed by qRT-PCR to quantify mRNA level ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mL of stabilization mix (RNAprotect Bacteria Reagent - Qiagen diluted with PBS in a 2:1 volume ratio) was applied on plates ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293 cells were transfected with 1:1:2 μg of packaging plasmids versus shRNA hairpins on the pLKO.1 vector using Effectene transfection reagent (Qiagen) 48 h prior to harvesting supernatants ...
-
bioRxiv - Genomics 2021Quote: ... and Vero E6 cells infected with 2 patient virus isolates was converted to cDNA using reverse transcriptase from qiaseq SARS-CoV-2 primer pool (Qiagen kit, cat no. 333896). APOBEC3b (sense ...
-
bioRxiv - Microbiology 2024Quote: ... used for DNA extraction of minipig blood and (NM-3) one negative control for the kit DNeasy PowerWater (Qiagen) used for the DNA extraction of water samples ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 2 min at 40 Hz using TissueLyser LT (Qiagen). 500 µl PBS-tween (0.01% ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 μg of RNA was treated with Dnase I (Qiagen), copied to cDNA using an Oligo dT and the SuperScript™ II Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mL of nickel-charged resin (Qiagen, Ni-NTA Agarose) was added to a column (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... using the QIAstat-Dx Respiratory SARS-CoV-2 Panel (Qiagen). Viral stocks were produced infecting at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2022Quote: ... in a 2 mL cryovial using a tissue lyser (Qiagen) and 0.2mm ceramic beads ...
-
bioRxiv - Microbiology 2021Quote: ... or using the QIAseq SARS-CoV-2 Primer Panel (Qiagen) (for organoid supernatants) ...
-
bioRxiv - Developmental Biology 2019Quote: ... slides were treated with 2 μg/ml Proteinase K (QIAGEN) for 5 minutes at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... QIAseq SARS-CoV-2 Primer Panel (Qiagen, cat. no. 333895) and QIAseq FX DNA Library Kit were used in order to prepare amplicon libraries for viral genome sequencing ...
-
bioRxiv - Immunology 2020Quote: ... and extension by 2 × multiplex PCR master mix (QIAGEN, USA) at 72 °C for 30 s ...
-
bioRxiv - Genomics 2022Quote: ... and ‘Sy-2’ plants using Genomic Tip (Qiagen, Hilden, Germany), and high-molecular-weight DNA (fragment length > 40 kb ...
-
bioRxiv - Neuroscience 2022Quote: ... and IRS solution (Qiagen Cat No./ID: 26000-50-2) for a custom protocol ...
-
bioRxiv - Microbiology 2022Quote: ... for 2×2min at 30Hz in a TissueLyser II (Qiagen). After homogenization ...
-
bioRxiv - Cell Biology 2023Quote: ... coverslips were treated with 2 mg/ml RNase A (QIAGEN) for 30 min at 37°C ...