Labshake search
Citations for Qiagen :
51 - 100 of 3083 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... sterile Dacron swabs (N = 11) and blank DNA extraction kits (N = 23)) using the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Germantown, MD) with minor modifications to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from d2 (n. 2 biological replicates) and d4 (n. 2 biological replicates) cells with QIAzol lysis reagent (Qiagen #79306), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: Genomic DNA was extracted from n=192 rhizosphere and n=192 bulk soil samples using the DNeasy PowerSoil kit (Qiagen, Hilden, Germany). Paired-end sequencing of a 300-bp sequence spanning the V4 region of the ribosomal 16 S rRNA was generated using the Illumina MiSeq platform (Illumina Inc. ...
-
bioRxiv - Epidemiology 2019Quote: ... Genomic DNA was extracted from female and male reproductive parts (RP, n = 1157) as well as from whole bodies (WB, n = 258) using DNeasy® Blood and Tissue Kit (Qiagen, Germany). We used flies from Pagirinya (PAG ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA (n=3/experimental group) was extracted from macrophages with RNeasy Mini Kit (Qiagen, USA) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and total RNA was extracted using the RNAeasy Mini kit (Qiagen, 74104; n = 3 independent experiments). Prior to library construction ...
-
bioRxiv - Genetics 2019Quote: ... antlers and faecal samples (n = 38) using Kit (QIAGEN), QIAamp® DNA Micro Kit (QIAGEN ...
-
bioRxiv - Biophysics 2021Quote: ... purified N protein was incubated with RNAse A (Qiagen) with 1:15 (RNAse A ...
-
bioRxiv - Microbiology 2020Quote: ... N RNA was purified using RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... N mRNA was purified with RNeasy mini kit (Qiagen).
-
bioRxiv - Bioengineering 2023Quote: ... and gDNA elimination columns (#74134, Qiagen, Germantown, MD n). RNA concentration and quality were assessed using a NanoDrop (#A38189 ...
-
bioRxiv - Cancer Biology 2022Quote: Spheroid and monolayer samples (technical replicates n=3) of MUC-1 and NCI-H295R cells were processed for RNA extraction using the RNeasy Mini kit (Qiagen), followed by DNA removal (TURBO DNA-free™ Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... n=10) was homogenized using the PowerGen 125 handheld homogenizer in QIAzol Lysis Reagent (Qiagen) and extracted using the RNeasy Plus Universal Mini Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... was purified from curd stomach milk collected from P7 offspring that were exposed to mCHD (n=4) or mHFD (n=4) using a combination of QIAzol and miRNeasy Mini Kit (217004; Qiagen, Toronto, ON, CA) as described previously (Izumi et al. ...
-
bioRxiv - Bioengineering 2021Quote: DNA contents in native/control kidneys (n = 4) and decellularized kidneys (n = 4) were measured using a Qiagen DNeasy Kit (Qiagen, Valencia, CA, USA). The tissues were initially minced and stored overnight at −80°C ...
-
bioRxiv - Physiology 2023Quote: DNA content in native/control kidneys (n = 4) and decellularized kidneys (n = 4) were measured using a Qiagen DNeasy Kit (Qiagen, Valencia, CA, USA). The tissues were initially minced and stored overnight at −80°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted (n=3) from the frozen endosperm tissue using the RNeasy PowerPlant kit (Qiagen). An on-column DNase digest was incorporated during the extraction ...
-
bioRxiv - Immunology 2023Quote: ... cells pooled from n = 3 - 5 mice / cohort) was isolated using the RNeasy Plus Mini Kit (Qiagen). Clariom S microarray analysis (Affymetrix ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from patient material (n=3) and organoids (xxx) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... 6 and 9 employing the RNeasy plant mini kit (Qiagen). RNA was quantified using Nanodrop (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: O/N cultures were mixed with RNA protect (QIAgen, UK) at a ratio of 1:2 and pelleted at 5000xg for 10 min ...
-
bioRxiv - Genetics 2020Quote: ... 4 dpe on-tet n=3) was extracted using the Qiagen RNeasy Mini Plus Kit (Qiagen, Hilden, Germany), which includes a column-based genomic DNA removal step ...
-
bioRxiv - Immunology 2022Quote: ... corpus (segment 6-7) and cauda (segment 8-10) samples using QIAzol Lysis Reagent (Qiagen) following the manufactureŕs recommendation using a bead-based tissue homogenizer (Retsch ...
-
bioRxiv - Genetics 2022Quote: ... and conventional extraction methods (n = 9) using a lysis buffer and purified using silica columns (Qiagen DNeasy Plant Kit Qiagen Inc, Hilden, Germany). All lysates were analyzed with a QubitTM 4 Fluorometer (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: ... the whole CNS was dissected from the snails (n=10) and homogenized using a TissueLyser LT (QIAGEN) in TRI reagent (#93289 ...
-
“A Proteogenomic workflow reveals distinct molecular phenotypes related to breast cancer appearance”bioRxiv - Systems Biology 2020Quote: All breast cancer specimens (n = 21) were processed through AllPrep (Qiagen) protocol for the lysis and extraction of RNA and proteins (Fig 1D) ...
-
bioRxiv - Physiology 2021Quote: Total liver RNA was extracted from n=10 mice using a RNeasy Plus mini kit (Qiagen, Hilden, Germany). Total gonadal adipose RNA was extracted using a modified Tri-reagent (Sigma-Aldrich ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA was extracted from pooled individuals (n = 10) using a DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). A continuous long-read library was prepared and sequenced using PacBio Sequel II technology by Berry Genomics (Berry Genomics Co ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from heparinised blood of SI and SH mice (n=3 per housing group) using the RNeasy Protect Animal Blood Kit (Qiagen). Extracted RNA was hybridised at UCL genomics following standard Affymetrix protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA from ∼250,000 neurons per sample (n = 3 samples per group) was extracted and purified (DNeasy Blood and Tissue DNA extraction kit, Qiagen) prior to RRBS (Ovation RRBS Methyl-Seq System ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was isolated from 3D samples (n=2-3) by combining a TRIzol-based cell lysis with a RNeasy Mini Kit (Qiagen). Samples were collected at aforementioned timepoints ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from single-cell clone or bulk GFP+ and GFP- cells (n = 3 with cells from three different mice in each group) using QIAzol lysis reagent (Qiagen). DNA was removed using the RNase-Free DNase Set (QIAGEN) ...
-
bioRxiv - Neuroscience 2019Quote: ... was extracted from P7 dissected neocortices separated from meninges of Ctrl and Nr2f1cKO mice (n=3) using the RNeasy Mini kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA was extracted from control and INPP5ED477N/D477N organoids (n=3 samples per genotype) using an RNeasy Plus Micro Kit (Qiagen) and reverse transcribed using Superscript™ IV VILO™ Master ezDNase enzyme (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2019Quote: ... total RNAs were extracted from wild-type and Cables2-deficient EpiLCs at 2 days post-induction (n = 3) using RNeasy Plus Mini Kit (Qiagen). RNA quality was evaluated using Agilent Bioanalyzer with RNA 6000 Pico kit (Agilent Technologies Japan ...
-
bioRxiv - Cell Biology 2022Quote: RNA was extracted from cryo-pulverized inguinal adipose tissue from freely-fed 14-day-old mice (n=3 male and female for PTPN23H/H and PTPN23+/+) using the RNeasy Mini Kit (74104; Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: Total RNA was isolated from untreated or RNP-transfected plerixafor-mobilized HD and SCD HSPCs (n=3 for each group) using the RNeasy Kit (QIAGEN) that includes a DNAse treatment step ...
-
bioRxiv - Biochemistry 2023Quote: ... the EcNhaA triple mutant was extracted from membranes with n-Dodecyl β-D-maltoside (DDM; Glycon) and purified by Ni-nitrilotriacetic acid (Ni-NTA; Qiagen) affinity chromatography ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was isolated from CTi400 and N/TERT-1 cells using RNeasy Plus mini kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... and non-inoculated G305-3M leaf segments collected along 10 different time points (0, 3, 6, 9, 12, 16, 24, 36, 48, 72 hpi) using the RNeasy Plant Mini Kit (Qiagen, Germany). The cDNA was synthesized from total RNA using a qScript™ cDNA Synthesis Kit (Quantabio ...
-
bioRxiv - Cell Biology 2022Quote: ... and organoids at the end of passage one subjected to two weeks of differentiation (n=3) using the RNeasy Mini Kit (Qiagen, 74104) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and GSC6-27 HEPACAM shRNA (n=3) cultures were washed in cold 1X PBS and total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, 74134) following manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from NPCs and their derived astrocytes (4 lines, n=3 per cell type) using a RNeasy mini kit (Qiagen, 74104). RNA samples were prepped using TruSeq® Stranded mRNA Library kit (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... 6 and 9 hours of treatment using RNeasy Plus Mini Kit (Qiagen, 74134), and was reverse-transcribed to cDNA using Transcriptor First Strand cDNA Synthesis Kit with random primers (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502, Qiagen) in the Bio-Rad CFX96 system ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP was first isolated using Ni-NTA beads (Qiagen, Valencia, CA) using a buffer with an imidazole gradient (20 mM Bis-Tris ...
-
bioRxiv - Immunology 2021Quote: RNA was extracted with RNeasy Mini kit (cat. n° 74106, Qiagen, Hilden, Germany), treated with the TURBO DNA-free™ kit (Thermo Fisher Scientific ...