Labshake search
Citations for Qiagen :
651 - 700 of 3083 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Formalin-Fixed Paraffin-Embedded (FFPE) tissue (3 samples) and fresh frozen tissue (1 sample, QiaAmp Blood mini kit, QIAcube, QIAgen). Two samples are reference samples (NA24385 and NA12892 ...
-
bioRxiv - Genomics 2022Quote: ... the supernatants were mixed with Sigma HIS-Select Nickel Affinity Gel (at a ratio of 3:1) equilibrated in lysis buffer before being added into a polypropylene column (Qiagen). After extensive washing with a cold lysis buffer ...
-
bioRxiv - Microbiology 2019Quote: Bacterial RNA was isolated from LB cultures at OD600nm 1 and 3 in biological replicates using the QIAzol lysis reagent (Qiagen). The quantity of the bacterial RNA samples was measured on a NanoDrop ND1000 system and their quality analyzed on the Agilent 2100 Bioanalyzer system with the Agilent RNA 6000 Nano kit protocol (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The LNA gapmers for lnc-FLii-1 and lnc-LSAMP-3 were designed and purchased along with negative control LNA from Qiagen. For transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Microbiology 2023Quote: ... round 1 and 3 virus infections of GeCKO-A549 cells using the midi gDNA extraction kit (Qiagen, Germantown, MD, USA). The sgRNA’s DNA copies were PCR amplified from the extracted gDNAs for next generation sequencing (Fig 1) ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... The qPCR reaction mixture (10 μL) comprised 1× Rotor-Gene SYBR green PCR mix (Qiagen), 500 nM of each primer ...
-
bioRxiv - Genetics 2021Quote: ... by mixing 1 μl of RT product with 10 μl of SYBR qPCR Mastermix (Qiagen) containing the appropriate primers (345 nM of forward primer and 345 nM of reverse primer) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... using a 10:1 ratio of binding buffer (a modified version of Qiagen’s PB buffer) to digestive mixture ...
-
bioRxiv - Molecular Biology 2021Quote: Ni-NTA agarose beads (Qiagen 70666-3)
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Physiology 2020Quote: ... existing media was removed and the resulting myotubes received either 750 µl of fresh DM alone or 750 µl DM containing 9 µl HiPerFectTransfection™ (Qiagen, UK) and 20 nmol Flexitube GeneSolutions™ (siUBR5 ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were co-transfected with the 9 × GCCG-reporter construct and the renilla-luciferase control vector using SuperFect (Qiagen, Valencia, CA) for 24 h ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was extracted and purified as described in [9] using the Quick-RNA MiniPrep Kit (Zymoresearch, Irvine, CA, USA) and RNeasy MinElute Cleanup Kit (QIAGEN, Hilden, Germany). Per sample at least 150 ng of high-quality RNA were obtained ...
-
bioRxiv - Microbiology 2019Quote: ... and the variants (single nucleotide changes and small deletion up to 50 nucleotides) were detected with the Fixed Ploidy Variant Detection tool in CLC Genomics Workbench version 9 (CLC, Bio-QIAGEN, Aarhus, Denmark). Variants falling in PE/PPE family genes were excluded from the analysis.
-
bioRxiv - Developmental Biology 2020Quote: ... and unfragmented genomic DNA (A260/A280 ≥ 1.8 and A260/A230 ≥ 1.9) was extracted from whole blood obtained from the subject and his parents using the Puregene Blood kit from Qiagen (Valencia, CA). Whole exome sequencing was performed using the service provided by Beijing Genomics Institute (Cambridge ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from fresh or cultured primary B cells using the RNeasy Minikit (Qiagen) or Trizol reagent (Ambion ...
-
bioRxiv - Immunology 2021Quote: ... RNA was isolated from the differentially stimulated B cells using the RNeasy Plus Micro Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was prepared from human or mouse B cells using QIAmp DNA Mini Kit (Qiagen), or from paraffin-embedded human IgD or IgA myeloma tissue sections (obtained from the University of Arkansas for Medical Science ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was extracted from B cell populations sorted in duplicates (Gentra Puregene Core Kit, Qiagen). Rearranged IGHV genes were sequenced by massive parallel sequencing ...
-
bioRxiv - Immunology 2021Quote: ... RNA was isolated from sorted B cells for each patient using the RNeasy Micro kit (Qiagen) with on-column DNase digestion ...
-
bioRxiv - Microbiology 2023Quote: ... gDNA was extracted using an isopropanol-ethanol purification kit (Puregene Yeast/Bact. Kit B from Qiagen) and following the manufacturer’s protocol including a 60-minute RNase A treatment ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... along with the human NaV β1 and β2 subunits (2 μg total plasmid DNA was transfected with a cDNA ratio of 10:1:1 for NaV1.X:β1:β2 subunits) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.). Human β1 and β2 cDNAs were cloned into plasmids encoding the CD8 receptor (CD8-IRES-hβ1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transiently co-transfected with NaV1.2 and the accessory β1 and β2 subunits (2 μg total plasmid DNA was transfected with a cDNA ratio of 10:1:1 for NaV1.2:β1:β2 subunits) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.). Human β1 and β2 cDNAs were cloned into plasmids encoding the CD8 receptor (CD8-IRES-hβ1 ...
-
bioRxiv - Microbiology 2020Quote: Total RNA extraction was performed using a squash buffer (10 mM Tris base, 1 mM EDTA, 50 mM NaCl) supplemented with 1:8 part Proteinase K (Qiagen, 15mg/ml). Mosquito abdomens with the midguts and heads with thoraces were individually collected in 50 μl of squash buffer at 7 and 14 days ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from homogenized lysate containing a range of 3×103 to 1×105 cells per sample using a ll Prep DNA/RNA Mini kit (Qiagen, #80204). RNA was purified and concentrated using RNAClean XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μL of plasma/EV suspension were mixed with 1000 μL Qiazol and 1 μL of a mix of 3 synthetic spike-in controls (Qiagen, Germany). After a 10-minute incubation at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: Adrenal glands were homogenized in ammonium-bicarbonate buffer (150 mM ammonium bicarbonate, pH 7) with TissueLyser (Qiagen). Protein content was assessed using BCA Protein Assay Kit (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2021Quote: DNA was extracted from 0.5-7 mg biomass using DNeasy Powersoil microbial extraction kit (Qiagen, Hilden, Germany) accordingly to manufacturer’s instructions and stored at -20°C ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA was isolated from roots of 7-day-old seedlings using RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and 7 were isolated using a Plant RNeasy Mini kit with DNase I treatment (Qiagen, Hilden, Germany). Three biological replicates were prepared for each tissue type ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA from the MC.7.G5 clone was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and from blood by using either DNeasy Blood & Tissue Kit (Qiagen ...