Labshake search
Citations for Qiagen :
601 - 650 of 2264 citations for 6H 5 Oxa 1 2a 4a triazacyclopenta cd pentalene 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Supernatants were filtered through a 0.22 µm syringe filter before application to 5 ml of nickel resin (Ni-NTA Superflow, QIAGEN) equilibrated in loading buffer (25 mM HEPES-KOH pH 7.6 ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293 cells were transfected with 1:1:2 μg of packaging plasmids versus shRNA hairpins on the pLKO.1 vector using Effectene transfection reagent (Qiagen) 48 h prior to harvesting supernatants ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 μg DNA ratio using Effectene transfection reagent (Qiagen). Recombinant luciferase-expressing viruses capable of a single round of replication were released into the cell medium and were harvested 48 h later ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 µg DNA ratio using effectene transfection reagent (Qiagen). Recombinant ...
-
bioRxiv - Microbiology 2023Quote: ... 5.0 x105 293T cells were co-transfected with HIV-1 Env-expressing and HIV-1 Tat-expressing plasmids at a ratio of 1:6 using Effectene (Qiagen) and incubated for 48 hours ...
-
bioRxiv - Plant Biology 2020Quote: Quantitative real-time PCR was performed in a volume of 5 mL QuantiTect Probe PCR Kit (Qiagen GmbH, Hilden, Germany) kit and an ABI 7900HT fast real-time PCR system (ThermoFisher Scientific Inc. ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was collected and subjected to affinity purification using 5 mL Hi-Trap column containing Ni-NTA resin (Qiagen) on an AKTA Pure 25L protein purification system (GE Healthcare) ...
-
bioRxiv - Biochemistry 2021Quote: ... and cDNA products containing the R2R adapter attached to their 5′ end were cleaned-up by using a MinElute column (Qiagen) to remove unused primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genetics 2021Quote: ... and E11 (5’-AGGAAAAAGGAAATAAATTA-3’) primers on pDH373 as a template generated a smaller fragment that was cleaned up by QIAGEN MinElute PCR Purification Kit (#28004) ...
-
bioRxiv - Genetics 2021Quote: Pools of 5 mites were ground to powder in liquid nitrogen and total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Genetics 2020Quote: ... in a 2 ml Eppendorf (Hamburg, Germany) tube using Stainless Steel Beads (5 mm) and the TissueLyzer (QIAGEN, Venlo, Netherlands). After an incubation time of 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were transfected at 60-80% confluence with 5 nM/1nM (MIN6, EndoCβ-H1, respectively) control or miR-125b mimics (Qiagen) or 50 nM of a mixture of four ONTARGETplus siRNAs against mouse Smad2 ...
-
bioRxiv - Microbiology 2019Quote: ... Epithelial cells were then recovered and stabilised by pelleting at 1000 rpm for 5 minutes followed by lysis in buffer RLT RNA lysis solution (Qiagen).
-
bioRxiv - Biochemistry 2021Quote: ... The RNA was prepared from 5 OD equivalents of stressed and unstressed cells using the RNeasy Plus RNA Isolation Kit (Qiagen). 500 ng RNA of the total isolated RNA were used as a template for the synthesis of cDNA using Oligo(dT ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were then aspirated using a freshly flame-pulled patch pipette (2.5 inner diameter) and placed into a 5 μl of lysis Buffer TCL (Qiagen, 1031576) + 1% 2-mercaptoethanol (Millipore-Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... LRRCC1-si2 (target sequence: 5’- TTA GAT GAC CAA ATT CTA CAA - 3’) and control siRNA (AllStars Negative Control) were purchased from Qiagen. siRNAs were delivered into cells using Lipofectamine RNAiMAX diluted in OptiMEM medium (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Immunology 2019Quote: ... Approximately 20 mg of jejunum were mixed with 600 μL of the prepared protein lysis buffer and homogenized using 5 mm stainless steel beads (Qiagen) and a TissueLyser II system (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: Total RNA was isolated from adult anaemic spleen 5 days after phenylhydrazine injections [56] using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: DNA and RNA were extracted from the cervical cancer tissues (5-10 mg) using the AllPrep DNA/RNA Micro Kit (QIAGEN) as described by the manufacturer ...
-
bioRxiv - Microbiology 2019Quote: ... 3 and 5 dpi maize leaves were ground in liquid nitrogen and total DNA was isolated with DNeasy Plant Mini kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs used were: AllStars Negative control siRNA (cat# 1027281) and si-Rab13 #8 (cat# SI02662702; target sequence: 5’-ATGGTCTTTCTTGGTATTAAA-3’) from Qiagen.
-
bioRxiv - Genomics 2019Quote: ... We used a 100 µm nozzle to sort single cells into 96-well plates containing 5 µl TCL buffer (Qiagen) with 1% beta-mercaptoethanol for Smart-seq2 and 384-well plates containing 0.6 µl 1% NP40 (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and dARC1 CA captured from clarified lysate using immobilised metal ion affinity on a 5 mL Ni2+-NTA superflow column (Qiagen). Bound dARC1 CA was eluted in non-reducing buffer (50 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng equivalent of pooled total RNA (5 slices per animal; 7 rats) was used to synthesize cDNA using an RT First Strand Kit (Qiagen). Pre-validated primers targeting rat CXCR4 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The entire flies were mechanically crushed for 30 s at 25 Hz using a 5-mm stainless steel bead in a TissueLyser (Qiagen). Three hundred μL of ACL solution and 20 μL of 16 g.L-1 proteinase K were then added to the samples ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 250 plants showing the long root phenotype of the revertant were selected at 5 DAS and pooled for DNA extraction using the DNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... followed by flow sorting with a Sony SH800Z (gating on calcein NVOC fluorescence levels) into individual wells of a 96-well plate containing 5 μL of Buffer RLT (Qiagen) and 1% β-mercaptoethanol.
-
bioRxiv - Cancer Biology 2021Quote: Driver mutations were derived from.15 CopyNumbers were calculated using the CNVKit package.16 RNA was isolated from cell cultures (+/− 5 μM AGI-5198) using the RNeasy kit (Qiagen). We performed paired-end sequencing of 2×100 with the Illumina Novaseq platform to obtain 8-10 GB per sample ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 to 20 mg of frozen tissue was dissociated using 400 μl of RLT Plus in a 2mL extraction tube containing a 5 mm diameter beads (Qiagen) and agitated at 30 HZ for twice 2 minutes in the TissueLyser II (Qiagen) ...
-
bioRxiv - Cancer Biology 2019Quote: Tumour tissue were collected into 2 ml tubes with pre-chilled steel beads (Qiagen Stainless Steel Beads, 5 mm, 69989) and stored at −80 °C freezer ...
-
bioRxiv - Neuroscience 2020Quote: RNA was extracted from third-instar larval CNS or adult heads (5-7 days post-pupation) with RNeasy Plus Micro kit (Qiagen). RNA isolation was followed with DNase digestion with Turbo DNA-free (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Bacterial cultures (5 to10 mL) from mid-exponential phase (OD600 = 0.5-0.6) were harvested and treated with RNAprotect reagent (Qiagen, Germantown, MD), and the cell pellet ...
-
bioRxiv - Cell Biology 2021Quote: Isolated Tert+ and Tert-cells (≤ 5 cells) were subjected to synthesize the complementary DNA (cDNA) using REPLI-g WTA Single Cell Kit (QIAGEN) and analyzed for gene expression by qRT-PCR ...
-
bioRxiv - Microbiology 2020Quote: ... mexicana Cas9 T7 procyclic promastigotes were transfected either with whole PCR reactions or 5 µL of DNA purified using the QIAquick PCR Purification Kit (Qiagen). 8 x 106 log phase cells were prepared by spinning down (1,000 x g for 10 min) ...
-
bioRxiv - Microbiology 2020Quote: ... Purified extracellular WT and Δtgif2k-b tachyzoites were treated with vehicle or 5 μM sodium arsenite for 2 h at 37°C and total RNA was extracted using RNeasy (Qiagen). The RNA concentration for each sample was measured using Nanodrop One (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2020Quote: ... All other tissues were homogenized in a SPEX CertiPrep 2010-230 Geno/Grinder (Cat No.: 12605297, Fischer Scientific) using 5 mm steel beads (Cat No.: 69989, Qiagen); tubes were shaken in 20 sec bursts at 1500 rpm ...
-
bioRxiv - Plant Biology 2021Quote: RNA was isolated from adult (5-week-old) WT and er/erl1/erl2 plants using a Plant RNeasy kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... ∼2.5×108 cells (0.5 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples from the GSK-3484862 and 5-azacytidine treated assays had RNA and DNA isolated simultaneously using the AllPrep DNA/RNA kit (Qiagen), whereas only RNA was isolated from decitabine samples by using the RNAzol total RNA protocol (Sigma) ...
-
bioRxiv - Microbiology 2022Quote: ... Nasal turbinates and lungs were collected from a subset of hamsters at 4 dpi and homogenized in 1ml or 5 ml of PBS with TissueRuptor (Qiagen), respectively ...
-
bioRxiv - Plant Biology 2022Quote: Grains were homogenized using mortar and pestle with liquid nitrogen while other tissues were homogenized in SPEX CertiPrep 2010-230 Geno/Grinder (Cat No.: 12605297, Fischer Scientific) using 5 mm steel beads (Cat No.: 69989, Qiagen). For grain samples ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 5-day-old vertically grown Arabidopsis thaliana seedlings root tissue using RNeasy Mini Kit (Qiagen, www.qiagen.com) with on-column DNA digestion to remove residual genomic DNA using RNase-free DNase according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... to produce 75-base pair single-end reads with aimed mean sequencing depth of >5 M reads per sample as recommended by the manufacturer (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... Blood was collected by cardiac puncture and harvested organs were homogenized in 500 μl PBS with two 5 mm stainless steel beads using a tissue lyser (Tissue-Lyser II, Qiagen) for two 2-minute rounds at 30 Hz and centrifuged to pellet debris for 10 minutes at 8,000 rpm ...
-
bioRxiv - Microbiology 2021Quote: ... placed in 250 μL PBS containing a 5 mm stainless steel bead and homogenized using a tissue lyser (Tissue-Lyser II, Qiagen) for 2-minutes at 30 Hz ...
-
bioRxiv - Microbiology 2020Quote: ... All samples were then passed 3-5 times through a 26G needle prior to RNA isolation using the RNAeasy mini kit from Qiagen. RNA concentrations were estimated by absorbance measurement at 260 and 280 nm ...