Labshake search
Citations for Qiagen :
501 - 550 of 1136 citations for 6 oxopiperidine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Digested protein was mixed with 3 ml of NTA super-flow resin (Qiagen) that had been pre-equilibrated in wash buffer ...
-
bioRxiv - Biophysics 2023Quote: The library preparation was done using the QIAseq UPX 3’ Transcriptome Kit (QIAGEN). A total of 10ng purified RNA was converted into cDNA NGS libraries ...
-
bioRxiv - Genetics 2022Quote: ... 10 μg dsRNA were transfected into 3×106 Drosophila cells using Effectene (QIAGEN).
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted from Calu-3 cells with RNeasy mini kit (Qiagen). Extracted RNA was quantified and purity was verified by Nanodrop 2000 spectrophotometer (ThermoFisher) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleared and filtered supernatants were applied to 3 mL Ni-NTA Agarose (QIAGEN) equilibrated in buffer B (20 mM HEPES/KOH pH 7.8 ...
-
bioRxiv - Plant Biology 2023Quote: ... Tissue was ground with 3 mm stainless steel beads in a TissueLyser (Qiagen) with intensity of 30 for 1 min ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Genomics 2023Quote: Approximately 3-4 million cells were solubilized with 1 mL QIAzol (Qiagen, 79306) and 0.2 mL chloroform in 5PRIME Phase-Lock Gel heavy tubes (QuantaBio ...
-
bioRxiv - Genetics 2024Quote: ... Insects were homogenized for 3 min at 30 Hz with TissueLyser II (Qiagen), using three 3 mm steel beads (TIS GmbH ...
-
bioRxiv - Microbiology 2024Quote: ... 3 times for 30 s at 30 Hz using Tissue Lyser II (Qiagen). After centrifugation at 2,000 rpm for 5 min ...
-
bioRxiv - Microbiology 2021Quote: Confluent 6-well plates of BAC16-iSLK.RTA cells were lysed using a DNeasy Blood and Tissue Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNAs were isolated from 6-month H19ΔICR/H19ΔICR and H19+/H19+ littermates (2 per genotype) using RNeasy Plus Mini Kit (Qiagen). Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Paired-end reads were mapped to the transcriptome (above) using default settings on CLC Genomics Workbench 6 (Qiagen) except that read alignments were done with a relaxed length fraction of 0.5 ...
-
bioRxiv - Genomics 2020Quote: ... We extracted genomic DNA from the above 6 stocks individually by using DNeasy blood and tissue kit (Qiagen), and measured the purity and concentration of the resulting DNA with NanoDrop ND-1000 spectrophotometer (Thermofisher) ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was collected from a single 6 cm dish using the DNEasy Blood & Tissue kit (69504, Qiagen). For both reps of day 0 ...
-
bioRxiv - Systems Biology 2020Quote: Three milliliters of cells from mid-log phase cultures were mixed with 6 mL RNAprotect Bacteria Reagent (Qiagen). Samples were mixed immediately by vortexing for 5 s ...
-
bioRxiv - Microbiology 2021Quote: ... IL-6 and β-actin cDNA were determined by QuantiFast SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) at the conditions ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted from cells grown in 6-well plates using RNeasy Mini Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... for 30 minutes at 37°C followed by beadbeating with 50μg 0.1mm zirconium beads for 6 minutes on the Tissuelyzer II (Qiagen) prior to loading onto the Qiacube HT ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were transiently transfected in 6 cm Ø dishes using Effectene Transfection Reagent according to manufacturer’s instructions (Qiagen) two days before the measurement ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted from infiltrated patches of 16C leaves at 6 dpi using TRIzol® Reagent (Qiagen). RNA concentration and RNA purity were measured using Nanodrop (ND-1000 ...
-
bioRxiv - Microbiology 2023Quote: ... and up to 6 ml of culture per isolate per medium was harvested using Bacterial RNAprotect (Qiagen 76506). Three biological replicates were generated for each condition.
-
bioRxiv - Physiology 2024Quote: ... The apical portion was homogenized in tissue lysis buffer (Supplement Table 6.) using a bead mill (Qiagen, TissueLyserII). Homogenates were sonicated ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from frozen Hepa 1-6 cell pellets using the RNeasy Mini kit (74106, QIAGEN) following the manufacturer’s instructions with an on-column DNase digestion step (79254 ...
-
bioRxiv - Biophysics 2021Quote: cfDNA was isolated from 2 mL of plasma for each sample via the QIAamp Circulating Nucleic Acid kit (Qiagen). ddPCR was performed using the QX200 Droplet Digital PCR System (Bio-Rad) ...
-
bioRxiv - Biochemistry 2019Quote: ... and the supernatant was subjected into 9+ 9_ļ_ Ni2+ -nitrilotriacetic acid (Ni2+ -NTA) agarose resin (Qiagen, Valencia, CA, USA) for affinity chromatography purification ...
-
bioRxiv - Biochemistry 2019Quote: ... Acid-phenol based method was used to isolate total RNA and then purified using RNAeasy mini kit (Qiagen,USA) after a DNAse treatment (TURBO™ DNase ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by extraction of viral nucleic acids using a commercial kit (QIAamp MinElute virus spin kit, Qiagen, Venlo, Netherlands). A portion (2.5 µl ...
-
bioRxiv - Neuroscience 2020Quote: ESR1 expression was manipulated with custom-designed locked nucleic acid (LNA™) 15-mer antisense oligonucleotides designed by Qiagen following Kelly & Goodson.41 The antisense oligo for ESR1 knockdown (ESR1-KD ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 mg of freeze-dried and ground roots were mixed with 1.6 mL of 1 M perchloric acid and homogenized in a TissueLyser II (Qiagen) in microtubes containing 6 glass beads of 2.8 mm in diameter ...
-
bioRxiv - Microbiology 2020Quote: ... Extraction of viral nucleic acids from clinical sample was performed with a QIAamp Viral RNA Mini Kit (Qiagen #52906) as described by manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... Nucleic acid was first extracted from each blood sample using QIAamp MinElute Virus Spin kits (Qiagen, Mississauga, Ontario, Canada) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Headless HA stalk proteins were expressed in 293F cells and purified using nickel-nitrilotriacetic acid agarose (no. 1018244, Qiagen) in 5-ml polypropylene columns (no ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acid sequence alignments and a phylogenetic tree of CEC3 homologs were generated using CLC Genomics Workbench8 (QIAGEN bioinformatics).
-
bioRxiv - Microbiology 2022Quote: ... followed by total nucleic acid extraction of 400 ul of pretreated stool using the EZ1 Virus Mini Kit v2.0 (Qiagen). Extracts were eluted in 60 ul volume.
-
bioRxiv - Microbiology 2022Quote: ... N-terminal His-tagged SlPR1 and SlChi3 proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant was collected and was mixed with a small volume of preequilibrated Ni-nitrilotriacetic acid (NTA) beads (Qiagen) for 2 h on a rocking platform at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 M urea [pH 8.0]) and His-tagged Tax proteins were precipitated with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen). After washing in buffer C (100 mM NaH2PO4 ...
-
bioRxiv - Neuroscience 2020Quote: ... PrP was expressed in Rosetta2(DE3)pLysS E.coli competent cells and purified by affinity chromatography using Ni2+-nitrilotriacetic acid Superflow resin (QIAGEN). In the RT-QuIC assay ...
-
bioRxiv - Neuroscience 2020Quote: ... was expressed in Rosetta2(DE3)pLysS E.coli competent cells and purified from inclusion bodies by affinity chromatography using Ni2+-nitrilotriacetic acid Superflow resin (QIAGEN). Recombinant hamster PrP (HaPrP ...
-
bioRxiv - Microbiology 2019Quote: Nucleic acids from the seven new isolates were extracted using a DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) or MasterPure Complete DNA and RNA Purification Kit (Epicentre ...
-
bioRxiv - Biochemistry 2021Quote: ... The ankyrin repeat domains were purified over a Ni-nitrilotriacetic acid column (2.5 ml column volume) according to the manufacturer’s instructions (QIAgen, Germany). Up to 200 mg of highly soluble ankyrin repeat domains were purified from one liter of E ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acids from each sample were extracted using QIAamp 96 DNA kit and Qiacube HT robot (both from Qiagen). Viral RNA yields were measured using a RT-qPCR assay targeting the rdrp gene as previously described[13].
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were equalized and His6-HA-SUMO1-conjugates were enriched on nickel-nitrilotriacetic acid (NiNTA) agarose beads (Qiagen, #L30210) as described in15 ...
-
bioRxiv - Bioengineering 2022Quote: ... The cells were then lysed and the nucleic acid was extracted using Qiagen Allprep DNA/RNA Mini Kit (Qiagen). Aliquots of DNA were sent to Novogene Co ...
-
bioRxiv - Microbiology 2022Quote: ... protein enrichment and purification was performed as in(Bertani et al., 1999) using a Ni2+ nitriloacetic acid metal-affinity column according to the manufacturer’s instructions (QIAGEN). Proteins were resolved by tricine-SDS-PAGE (Schägger ...
-
bioRxiv - Immunology 2022Quote: ... The supernatant was harvested at day 4 after transfection and incubated with Ni-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen). The purification was carried out using gravity flow column and eluted with imidazole-containing buffer as previously described57,58 ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was extracted using hot acid-phenol (Uppuluri et al., 2007) and cleaned up using the RNeasy kit (Qiagen). Libraries were prepared using the NuGEN Universal Plus mRNA kit ...
-
bioRxiv - Microbiology 2023Quote: ... Extractions of viral nucleic acids from 140 µl samples were performed with the QIAamp Viral RNA Mini Kit (Qiagen), according to the manufacturer’s protocol ...